G303930


Basic Information

Item Value
gene id G303930
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 1555674 ~ 1555874 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU345328
AGCATTTATGCCACCTCTGAGCAGCATTAAAAAGTCTGTGTAAAGACACCTAAATGCCACTTCAGAAGTGCTTCTGTGCCACATTTGCAATGTAAATTTGGCAATATAGACGCCCTATTGGCCGCTGGATCACACGTCAACGGCGCCACCATATTTGTAGGGGCAACATGCCGTAACTCTCATAAGTGGACTGAAGAAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU345328 True 201 lncRNA 0.45 1 1555674 1555874

Neighbor

gene id symbol gene type direction distance location
CI01000092_01163367_01169844 NA coding upstream 384905 1163308 ~ 1170769 (+)
CI01000092_01050305_01051867 NA coding upstream 503214 1050305 ~ 1052460 (+)
CI01000092_01034513_01049419 MAML2 coding upstream 506255 1034513 ~ 1049419 (+)
CI01000092_00964013_00967452 NA coding upstream 588199 963887 ~ 980369 (+)
CI01000092_00887219_00908525 NA coding upstream 647149 887219 ~ 908525 (+)
CI01000092_01625114_01626286 NA coding downstream 68733 1624607 ~ 1626717 (+)
CI01000092_01871020_01880095 NA coding downstream 315146 1871020 ~ 1882078 (+)
CI01000092_01889654_01894899 NA coding downstream 333780 1889654 ~ 1895088 (+)
CI01000092_01912280_01944807 ABCG1 coding downstream 356406 1912280 ~ 1945217 (+)
CI01000092_01962495_01963651 NA coding downstream 406621 1962495 ~ 1963887 (+)
G303860 NA non-coding upstream 69755 1458466 ~ 1485919 (+)
G303899 NA non-coding upstream 105427 1450042 ~ 1450247 (+)
G303892 NA non-coding upstream 128886 1426568 ~ 1426788 (+)
G303798 NA non-coding upstream 170730 1356197 ~ 1384944 (+)
G303833 NA non-coding upstream 232774 1319009 ~ 1322900 (+)
G303863 NA non-coding downstream 2272 1558146 ~ 1562538 (+)
G303864 NA non-coding downstream 19223 1575097 ~ 1585956 (+)
G303952 NA non-coding downstream 31412 1587286 ~ 1587761 (+)
G303960 NA non-coding downstream 54284 1610158 ~ 1610843 (+)
G303970 NA non-coding downstream 65466 1621340 ~ 1621582 (+)
G303768 NA other upstream 239151 1315443 ~ 1316523 (+)
G304938 NA other downstream 761918 2317792 ~ 2318234 (+)
G305584 NA other downstream 2111434 3667308 ~ 3667965 (+)
G305596 NA other downstream 2170473 3726347 ~ 3863135 (+)

Expression


Co-expression Network