G303970


Basic Information

Item Value
gene id G303970
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 1621340 ~ 1621582 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU345369
CCTGGATATGCCACATAGACTACTTTTAGAGGAATTTTAAGACAATGTACCTTATTTTCATTATACTTAATTAGCTAATATGTTTAAATTACACAGCTATGCTGGAAAGTGGTTGCCTATGGCAGTGGTCAGTTACACAGTTTGCTAATTATGCAAAACTTGACCAATCAGAATCAAACTTTGACTTTGAGCTGTTAAAGTTAAAGGTGAATATGGAAAAATCCACGCAATTGTGAAGTCCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU345369 True 243 lncRNA 0.35 1 1621340 1621582

Neighbor

gene id symbol gene type direction distance location
CI01000092_01163367_01169844 NA coding upstream 450571 1163308 ~ 1170769 (+)
CI01000092_01050305_01051867 NA coding upstream 568880 1050305 ~ 1052460 (+)
CI01000092_01034513_01049419 MAML2 coding upstream 571921 1034513 ~ 1049419 (+)
CI01000092_00964013_00967452 NA coding upstream 653865 963887 ~ 980369 (+)
CI01000092_00887219_00908525 NA coding upstream 712815 887219 ~ 908525 (+)
CI01000092_01625114_01626286 NA coding downstream 3025 1624607 ~ 1626717 (+)
CI01000092_01871020_01880095 NA coding downstream 249438 1871020 ~ 1882078 (+)
CI01000092_01889654_01894899 NA coding downstream 268072 1889654 ~ 1895088 (+)
CI01000092_01912280_01944807 ABCG1 coding downstream 290698 1912280 ~ 1945217 (+)
CI01000092_01962495_01963651 NA coding downstream 340913 1962495 ~ 1963887 (+)
G303960 NA non-coding upstream 10497 1610158 ~ 1610843 (+)
G303952 NA non-coding upstream 33579 1587286 ~ 1587761 (+)
G303864 NA non-coding upstream 35384 1575097 ~ 1585956 (+)
G303863 NA non-coding upstream 58802 1558146 ~ 1562538 (+)
G303930 NA non-coding upstream 65466 1555674 ~ 1555874 (+)
G303972 NA non-coding downstream 1155 1622737 ~ 1623401 (+)
G304551 NA non-coding downstream 87296 1708878 ~ 1709092 (+)
G304583 NA non-coding downstream 116368 1737950 ~ 1738317 (+)
G304650 NA non-coding downstream 221624 1843206 ~ 1843628 (+)
G304659 NA non-coding downstream 242548 1864130 ~ 1864418 (+)
G303768 NA other upstream 304817 1315443 ~ 1316523 (+)
G304938 NA other downstream 696210 2317792 ~ 2318234 (+)
G305584 NA other downstream 2045726 3667308 ~ 3667965 (+)
G305596 NA other downstream 2104765 3726347 ~ 3863135 (+)

Expression


Co-expression Network