G304694


Basic Information

Item Value
gene id G304694
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 2054489 ~ 2054712 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU346202
GAACTATAAAAACAAATAACACAGAACTACATTATCAGTGGAAAAAAAATAAAGATAGCCTCATAGTTATAGTTTCTAGTTTCCATTTTTTCATAAAACAAAATTGTAGTAGTAGATTTTTATTTTTTTCCCCCTAAAACTAATCAGAGGATTAAAAATAAGCATACGTAGTCTACCAAATTCTTTCATTCAAAAGACTACACTCTTGTTGCTTAAAGTTCGAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU346202 True 224 lncRNA 0.27 1 2054489 2054712

Neighbor

gene id symbol gene type direction distance location
CI01000092_01989763_02003920 PGM2L1 coding upstream 50359 1989763 ~ 2004130 (+)
CI01000092_01985290_01986640 NA coding upstream 67802 1985290 ~ 1986687 (+)
CI01000092_01962495_01963651 NA coding upstream 90602 1962495 ~ 1963887 (+)
CI01000092_01912280_01944807 ABCG1 coding upstream 109272 1912280 ~ 1945217 (+)
CI01000092_01889654_01894899 NA coding upstream 159401 1889654 ~ 1895088 (+)
CI01000092_02186791_02187942 NA coding downstream 132079 2186791 ~ 2187942 (+)
CI01000092_02279826_02285934 NA coding downstream 221800 2276512 ~ 2286079 (+)
CI01000092_02358901_02363225 NA coding downstream 303191 2357903 ~ 2364462 (+)
CI01000092_02395791_02407508 NA coding downstream 340889 2395601 ~ 2407642 (+)
CI01000092_02411552_02412283 NA coding downstream 356840 2411552 ~ 2413511 (+)
G304690 NA non-coding upstream 7865 2046381 ~ 2046624 (+)
G304687 NA non-coding upstream 12657 2041528 ~ 2041832 (+)
G304633 NA non-coding upstream 18564 2005294 ~ 2035925 (+)
G304672 NA non-coding upstream 94958 1959255 ~ 1959531 (+)
G304671 NA non-coding upstream 100662 1953098 ~ 1953827 (+)
G304700 NA non-coding downstream 19619 2074331 ~ 2074605 (+)
G304686 NA non-coding downstream 24735 2079447 ~ 2079740 (+)
G304816 NA non-coding downstream 41928 2096640 ~ 2096939 (+)
G304828 NA non-coding downstream 94802 2149514 ~ 2151387 (+)
G304889 NA non-coding downstream 167693 2222405 ~ 2222761 (+)
G303768 NA other upstream 737966 1315443 ~ 1316523 (+)
G304938 NA other downstream 263080 2317792 ~ 2318234 (+)
G305584 NA other downstream 1612596 3667308 ~ 3667965 (+)
G305596 NA other downstream 1671635 3726347 ~ 3863135 (+)

Expression


Co-expression Network