G304700



Basic Information


Item Value
gene id G304700
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 2074331 ~ 2074605 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU346208
GTAATTTTGAAGACATTGAATTAAACGTAAACACAGCTTTTGTGTCTTTATAAGCTTTTCCGCATACATTCTGGCCCGGATAATCATCACATAGGGGAGAGCGGGGCACAACCTAATGCTTTTTGACTTTCTCAGTTTGTGTAAATCTACTTAGGGTTCAGAGAATTTCTTTTGTTCCACATTAATTTCACACGTGTCTGGTACAAATATGTGGCTTTGTTTCATTAATACAGAGTACAGGTGCTGGTCATATAATTAGAATATCATCAAAAAGT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU346208 True 275 lncRNA 0.36 1 2074331 2074605
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000092_01989763_02003920 PGM2L1 coding upstream 70201 1989763 ~ 2004130 (+)
CI01000092_01985290_01986640 NA coding upstream 87644 1985290 ~ 1986687 (+)
CI01000092_01962495_01963651 NA coding upstream 110444 1962495 ~ 1963887 (+)
CI01000092_01912280_01944807 ABCG1 coding upstream 129114 1912280 ~ 1945217 (+)
CI01000092_01889654_01894899 NA coding upstream 179243 1889654 ~ 1895088 (+)
CI01000092_02186791_02187942 NA coding downstream 112186 2186791 ~ 2187942 (+)
CI01000092_02279826_02285934 NA coding downstream 201907 2276512 ~ 2286079 (+)
CI01000092_02358901_02363225 NA coding downstream 283298 2357903 ~ 2364462 (+)
CI01000092_02395791_02407508 NA coding downstream 320996 2395601 ~ 2407642 (+)
CI01000092_02411552_02412283 NA coding downstream 336947 2411552 ~ 2413511 (+)
G304694 NA non-coding upstream 19619 2054489 ~ 2054712 (+)
G304690 NA non-coding upstream 27707 2046381 ~ 2046624 (+)
G304687 NA non-coding upstream 32499 2041528 ~ 2041832 (+)
G304633 NA non-coding upstream 38406 2005294 ~ 2035925 (+)
G304672 NA non-coding upstream 114800 1959255 ~ 1959531 (+)
G304686 NA non-coding downstream 4842 2079447 ~ 2079740 (+)
G304816 NA non-coding downstream 22035 2096640 ~ 2096939 (+)
G304828 NA non-coding downstream 74909 2149514 ~ 2151387 (+)
G304889 NA non-coding downstream 147800 2222405 ~ 2222761 (+)
G304894 NA non-coding downstream 158031 2232636 ~ 2232915 (+)
G303768 NA other upstream 757808 1315443 ~ 1316523 (+)
G304938 NA other downstream 243187 2317792 ~ 2318234 (+)
G305584 NA other downstream 1592703 3667308 ~ 3667965 (+)
G305596 NA other downstream 1651742 3726347 ~ 3863135 (+)

Expression


G304700 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G304700 Expression in each Bioproject

Bar chart with 25 bars.
G304700 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network