G304955


Basic Information

Item Value
gene id G304955
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 2350720 ~ 2350923 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU346490
GAAACGCGCCGGCGCGTTTTGCAGGATTTTTTCACATTGCAGCAAAACAGACTTAAAATACTGACATACTATGTCATAGAAACAGAAGTAATATATCAATTGAAACTATAGAATGTCTTCTTTTATTTGTGTACACTCAGAGTAAAAACAAAATGTTGTGCTTTTTGCAAAATAAAGAAAACTAACATGATGCGTGATCTGTCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU346490 True 204 lncRNA 0.34 1 2350720 2350923

Neighbor

gene id symbol gene type direction distance location
CI01000092_02279826_02285934 NA coding upstream 64641 2276512 ~ 2286079 (+)
CI01000092_02186791_02187942 NA coding upstream 162778 2186791 ~ 2187942 (+)
CI01000092_01989763_02003920 PGM2L1 coding upstream 346590 1989763 ~ 2004130 (+)
CI01000092_01985290_01986640 NA coding upstream 364033 1985290 ~ 1986687 (+)
CI01000092_01962495_01963651 NA coding upstream 386833 1962495 ~ 1963887 (+)
CI01000092_02358901_02363225 NA coding downstream 6980 2357903 ~ 2364462 (+)
CI01000092_02395791_02407508 NA coding downstream 44678 2395601 ~ 2407642 (+)
CI01000092_02411552_02412283 NA coding downstream 60629 2411552 ~ 2413511 (+)
CI01000092_02418597_02419541 NA coding downstream 67485 2418408 ~ 2419996 (+)
CI01000092_02470059_02471839 OR112-1 coding downstream 118429 2469352 ~ 2471951 (+)
G304934 NA non-coding upstream 39079 2311399 ~ 2311641 (+)
G304930 NA non-coding upstream 50201 2300294 ~ 2300519 (+)
G304907 NA non-coding upstream 92033 2258273 ~ 2258687 (+)
G304906 NA non-coding upstream 93070 2257366 ~ 2257650 (+)
G304901 NA non-coding upstream 106443 2244072 ~ 2244277 (+)
G304963 NA non-coding downstream 30335 2381258 ~ 2381543 (+)
G304966 NA non-coding downstream 43207 2394130 ~ 2394368 (+)
G304967 NA non-coding downstream 44987 2395910 ~ 2396126 (+)
G304968 NA non-coding downstream 51272 2402195 ~ 2402505 (+)
G304969 NA non-coding downstream 54215 2405138 ~ 2405562 (+)
G304938 NA other upstream 32486 2317792 ~ 2318234 (+)
G303768 NA other upstream 1034197 1315443 ~ 1316523 (+)
G305584 NA other downstream 1316385 3667308 ~ 3667965 (+)
G305596 NA other downstream 1375424 3726347 ~ 3863135 (+)

Expression


Co-expression Network