G304984


Basic Information

Item Value
gene id G304984
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 2448386 ~ 2448653 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU346522
TAACATGGACTCTTGCTCATTGGTTACTTCCTGTCTCTCTCCTGTATAAATAGACATGCATTTCCACTGCTACTTTGCGAAGTATTGCCAGTTTATCACTGCCTTACCAAGTGTTTCTCATTGCCTATTTTCTTGCCTTCTTGTTACTGACCATTGTGCTTGCTTTATTGGATTTTTGCCTTTTGGATATCGTTTTTGCTGTGGTTGCCTGTTTGGACTGATTTCTTGTCACTGATTATTCTGCCTGCCTTATCAACTACGTCTCTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU346522 True 268 lncRNA 0.41 1 2448386 2448653

Neighbor

gene id symbol gene type direction distance location
CI01000092_02418597_02419541 NA coding upstream 28390 2418408 ~ 2419996 (+)
CI01000092_02411552_02412283 NA coding upstream 35603 2411552 ~ 2413511 (+)
CI01000092_02395791_02407508 NA coding upstream 40875 2395601 ~ 2407642 (+)
CI01000092_02358901_02363225 NA coding upstream 83924 2357903 ~ 2364462 (+)
CI01000092_02279826_02285934 NA coding upstream 162307 2276512 ~ 2286079 (+)
CI01000092_02470059_02471839 OR112-1 coding downstream 20699 2469352 ~ 2471951 (+)
CI01000092_02661524_02662121 NA coding downstream 212730 2661383 ~ 2662183 (+)
CI01000092_02721458_02724152 NA coding downstream 272740 2721393 ~ 2724152 (+)
CI01000092_02739990_02745224 NA coding downstream 291337 2739990 ~ 2745247 (+)
CI01000092_02818349_02838255 NA coding downstream 368967 2817620 ~ 2838255 (+)
G304980 NA non-coding upstream 7118 2440977 ~ 2441268 (+)
G304973 NA non-coding upstream 38653 2409296 ~ 2409733 (+)
G304972 NA non-coding upstream 39566 2408206 ~ 2408820 (+)
G304987 NA non-coding downstream 13208 2461861 ~ 2462108 (+)
G305084 NA non-coding downstream 60389 2509042 ~ 2524185 (+)
G305071 NA non-coding downstream 167584 2616237 ~ 2617160 (+)
G305137 NA non-coding downstream 254112 2702765 ~ 2702979 (+)
G304938 NA other upstream 130152 2317792 ~ 2318234 (+)
G303768 NA other upstream 1131863 1315443 ~ 1316523 (+)
G305584 NA other downstream 1218655 3667308 ~ 3667965 (+)
G305596 NA other downstream 1277694 3726347 ~ 3863135 (+)

Expression


Co-expression Network