G305171



Basic Information


Item Value
gene id G305171
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 2717974 ~ 2718193 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU346761
GACAAGCCATGCTGCTGTCACGCCACAGATCATGTTCTCACGCAGTGAAAAAGGTACATCGCAGAGCAAAGAGGACACTGACAACGTGTCGACAGACAAGGCAGAGCAGGTTACTTTTGATATGAAACAAAGTCTAAAATTTCAAATATTGTAATTTTTAAAGAAATTTAAACAATAAATACCATTTTGTGGCTCTTTAATGTGTCATGACAGATCGCTG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU346761 True 220 lncRNA 0.39 1 2717974 2718193

Neighbor


gene id symbol gene type direction distance location
CI01000092_02661524_02662121 NA coding upstream 55801 2661383 ~ 2662183 (+)
CI01000092_02470059_02471839 OR112-1 coding upstream 246023 2469352 ~ 2471951 (+)
CI01000092_02418597_02419541 NA coding upstream 297978 2418408 ~ 2419996 (+)
CI01000092_02411552_02412283 NA coding upstream 305191 2411552 ~ 2413511 (+)
CI01000092_02395791_02407508 NA coding upstream 310463 2395601 ~ 2407642 (+)
CI01000092_02721458_02724152 NA coding downstream 3200 2721393 ~ 2724152 (+)
CI01000092_02739990_02745224 NA coding downstream 21797 2739990 ~ 2745247 (+)
CI01000092_02818349_02838255 NA coding downstream 99427 2817620 ~ 2838255 (+)
CI01000092_02958119_02966042 WRB coding downstream 239831 2958024 ~ 2966463 (+)
CI01000092_02977237_02979350 SH3BGR coding downstream 259044 2977237 ~ 2979378 (+)
G305137 NA non-coding upstream 14995 2702765 ~ 2702979 (+)
G305071 NA non-coding upstream 100814 2616237 ~ 2617160 (+)
G305084 NA non-coding upstream 193789 2509042 ~ 2524185 (+)
G304987 NA non-coding upstream 255866 2461861 ~ 2462108 (+)
G305172 NA non-coding downstream 249 2718442 ~ 2718646 (+)
G305133 NA non-coding downstream 9110 2727303 ~ 2727705 (+)
G305180 NA non-coding downstream 16244 2734437 ~ 2734688 (+)
G305183 NA non-coding downstream 19319 2737512 ~ 2737868 (+)
G305187 NA non-coding downstream 29308 2747501 ~ 2747707 (+)
G304938 NA other upstream 399740 2317792 ~ 2318234 (+)
G303768 NA other upstream 1401451 1315443 ~ 1316523 (+)
G305584 NA other downstream 949115 3667308 ~ 3667965 (+)
G305596 NA other downstream 1008154 3726347 ~ 3863135 (+)

Expression



Co-expression Network