G305206



Basic Information


Item Value
gene id G305206
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 2773011 ~ 2786207 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU346799
TCTGCTATGTAGTTGGAGTCAGTCAGATTGGCTTCCACCTGAGTAATAATGGCTGTACAGGCGCCATAACTATCAGATGGCAGAAAATCCCTTTTCCCCAGGACCGCATTCAACAGGGAACTCTTTCCATCTCCTGATTTTCCAAAAATCCCCATGGTTGCTTTCTTCCTGCTGACTTTATTCATTTGATTTATCTTTGAAATGATGTCTCTGTTCATCAAGAAAGCTTGATCTAAGTTGTGATTGACAATATCCATGATTTTCTTTGCATTCTCCATGATCTCCATAGCTGTTGTCAGCGGTGACTCTATGCCCGAGACAGACGATTCATGATCACGCTTTCTTTTAGTACCTTGGCTAGCCATTGTGAGATCGATGGAAAGTCCCTGTCCTTCGTCTGTGTATATGTGTCTCTAGGAAAGGTCAGGTGTGTCTTAAGGCTTGGATCTGAAGTGCTACTTTCCTCTTCCTGCT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU346799 True 474 lncRNA 0.43 4 2773011 2786207

Neighbor


gene id symbol gene type direction distance location
CI01000092_02739990_02745224 NA coding upstream 27764 2739990 ~ 2745247 (+)
CI01000092_02721458_02724152 NA coding upstream 48859 2721393 ~ 2724152 (+)
CI01000092_02661524_02662121 NA coding upstream 110838 2661383 ~ 2662183 (+)
CI01000092_02470059_02471839 OR112-1 coding upstream 301060 2469352 ~ 2471951 (+)
CI01000092_02418597_02419541 NA coding upstream 353015 2418408 ~ 2419996 (+)
CI01000092_02818349_02838255 NA coding downstream 31413 2817620 ~ 2838255 (+)
CI01000092_02958119_02966042 WRB coding downstream 171817 2958024 ~ 2966463 (+)
CI01000092_02977237_02979350 SH3BGR coding downstream 191030 2977237 ~ 2979378 (+)
CI01000092_03007267_03029327 NA coding downstream 221060 3007267 ~ 3029327 (+)
CI01000092_03080030_03082866 PCP4 coding downstream 293355 3079562 ~ 3083624 (+)
G305188 NA non-coding upstream 24417 2748361 ~ 2748594 (+)
G305187 NA non-coding upstream 25304 2747501 ~ 2747707 (+)
G305183 NA non-coding upstream 35143 2737512 ~ 2737868 (+)
G305180 NA non-coding upstream 38323 2734437 ~ 2734688 (+)
G305133 NA non-coding upstream 45306 2727303 ~ 2727705 (+)
G305219 NA non-coding downstream 10479 2796686 ~ 2796940 (+)
G305220 NA non-coding downstream 12427 2798634 ~ 2798880 (+)
G305230 NA non-coding downstream 37072 2823279 ~ 2823507 (+)
G305244 NA non-coding downstream 52855 2839062 ~ 2839329 (+)
G305164 NA non-coding downstream 60659 2846866 ~ 2849443 (+)
G304938 NA other upstream 454777 2317792 ~ 2318234 (+)
G303768 NA other upstream 1456488 1315443 ~ 1316523 (+)
G305584 NA other downstream 881101 3667308 ~ 3667965 (+)
G305596 NA other downstream 940140 3726347 ~ 3863135 (+)

Expression



Co-expression Network