G305558


Basic Information

Item Value
gene id G305558
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 3586872 ~ 3587109 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU347181
TGAGAACAGCCTTCTAACGCTGTCAAAACAGCTATTTGCTCTATAATGGCAAACGAAACAAAAAACAGAAAATAAAGAGAGGACTTTGACCCCGCTGCTGTGCTGTTCGCCCGCACTCGAAAAAAAAAGAGAAGTTCAACCAAAAAGCTTGACTCGTCTTCTAGCAGACACTTGCTTGCAGAGAACAGGAACAAACACCGTTCGGCTCCGAAGCGAAAAGCTGAAGATGCAACGCACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU347181 True 238 lncRNA 0.45 1 3586872 3587109

Neighbor

gene id symbol gene type direction distance location
CI01000092_03551674_03573437 NA coding upstream 13380 3551674 ~ 3573492 (+)
CI01000092_03532136_03542761 SIRT2 coding upstream 43989 3532136 ~ 3542883 (+)
CI01000092_03478431_03479274 GJD1A coding upstream 107079 3478431 ~ 3479793 (+)
CI01000092_03433283_03442900 GLTSCR2 coding upstream 143912 3433283 ~ 3442960 (+)
CI01000092_03329908_03348045 NA coding upstream 238553 3329908 ~ 3348319 (+)
CI01000092_03693715_03694890 NA coding downstream 103441 3690550 ~ 3695228 (+)
CI01000092_03725440_03728304 NA coding downstream 135934 3723043 ~ 3728325 (+)
CI01000092_03816152_03827312 AXL coding downstream 229043 3816152 ~ 3827361 (+)
CI01000092_03828205_03831437 NA coding downstream 241096 3828205 ~ 3831775 (+)
CI01000092_04205017_04213986 NA coding downstream 617908 4205017 ~ 4214128 (+)
G305535 NA non-coding upstream 10919 3507282 ~ 3575953 (+)
G305529 NA non-coding upstream 141755 3444826 ~ 3445117 (+)
G305499 NA non-coding upstream 186384 3399821 ~ 3400488 (+)
G305493 NA non-coding upstream 196634 3384815 ~ 3390238 (+)
G305488 NA non-coding upstream 207966 3376206 ~ 3378906 (+)
G305561 NA non-coding downstream 10603 3597712 ~ 3598766 (+)
G305562 NA non-coding downstream 11780 3598889 ~ 3599275 (+)
G305565 NA non-coding downstream 70955 3658064 ~ 3661242 (+)
G305581 NA non-coding downstream 75188 3662297 ~ 3662516 (+)
G305583 NA non-coding downstream 79629 3666738 ~ 3667015 (+)
G304938 NA other upstream 1268638 2317792 ~ 2318234 (+)
G303768 NA other upstream 2270349 1315443 ~ 1316523 (+)
G305584 NA other downstream 80199 3667308 ~ 3667965 (+)
G305596 NA other downstream 139238 3726347 ~ 3863135 (+)

Expression


Co-expression Network