G305583


Basic Information

Item Value
gene id G305583
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 3666738 ~ 3667015 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU347217
CAAAGGGGTCCAGCGCTCAGAGACGAGTGAGCTCACGCCGGCTCAGCCCCCACATGCCTCACTCTCTCCGCCCAGAGAGCCTTCTCCTGTCCTGTTCTCCTGCCCTGAACAGCATCCCTCAGCTGAGGCGAGCGACCTCGTTTCATTTGGCGGTTTTGAGGACGAGCCGCTCGATGACAGCATGTCATTGGCGGTTTCTGAAACGGAGGAATGGGCCGGCGACTCTGAAGACCCCGCCCACCTGCCGCCTTTGGAGCCCATCGACGCCAGGGTTATTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU347217 True 278 lncRNA 0.62 1 3666738 3667015

Neighbor

gene id symbol gene type direction distance location
CI01000092_03551674_03573437 NA coding upstream 93246 3551674 ~ 3573492 (+)
CI01000092_03532136_03542761 SIRT2 coding upstream 123855 3532136 ~ 3542883 (+)
CI01000092_03478431_03479274 GJD1A coding upstream 186945 3478431 ~ 3479793 (+)
CI01000092_03433283_03442900 GLTSCR2 coding upstream 223778 3433283 ~ 3442960 (+)
CI01000092_03329908_03348045 NA coding upstream 318419 3329908 ~ 3348319 (+)
CI01000092_03693715_03694890 NA coding downstream 23535 3690550 ~ 3695228 (+)
CI01000092_03725440_03728304 NA coding downstream 56028 3723043 ~ 3728325 (+)
CI01000092_03816152_03827312 AXL coding downstream 149137 3816152 ~ 3827361 (+)
CI01000092_03828205_03831437 NA coding downstream 161190 3828205 ~ 3831775 (+)
CI01000092_04205017_04213986 NA coding downstream 538002 4205017 ~ 4214128 (+)
G305581 NA non-coding upstream 4222 3662297 ~ 3662516 (+)
G305565 NA non-coding upstream 5496 3658064 ~ 3661242 (+)
G305562 NA non-coding upstream 67463 3598889 ~ 3599275 (+)
G305561 NA non-coding upstream 67972 3597712 ~ 3598766 (+)
G305558 NA non-coding upstream 79629 3586872 ~ 3587109 (+)
G305585 NA non-coding downstream 992 3668007 ~ 3668223 (+)
G305590 NA non-coding downstream 4428 3671443 ~ 3674407 (+)
G305588 NA non-coding downstream 9754 3676769 ~ 3677771 (+)
G305589 NA non-coding downstream 10868 3677883 ~ 3679488 (+)
G305591 NA non-coding downstream 15242 3682257 ~ 3682623 (+)
G304938 NA other upstream 1348504 2317792 ~ 2318234 (+)
G303768 NA other upstream 2350215 1315443 ~ 1316523 (+)
G305584 NA other downstream 293 3667308 ~ 3667965 (+)
G305596 NA other downstream 59332 3726347 ~ 3863135 (+)

Expression


Co-expression Network