G305667



Basic Information


Item Value
gene id G305667
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 3922197 ~ 3922444 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU347328
GGAGGCGTGATGCACGAAAGGGGCTTTTTTTAAAATATGCTTTATTTTTGTAATACGGCTAGGTGCCACTAGTGTTGCAGAAACTACATACTTCACCTCTAAAGGTGGATTTGTCTCACTGATCAGGCCATCAACATAAGGGACAATGTACATTCATCTTCTCTAATTCATCAGCTGTCAATCATCAGCTTTGACCACAATGTTTTAGGCCACAGAGTCTCTTGACGAACCGCTGATCTCTGTCCACC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU347328 True 248 lncRNA 0.43 1 3922197 3922444
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000092_03828205_03831437 NA coding upstream 90422 3828205 ~ 3831775 (+)
CI01000092_03816152_03827312 AXL coding upstream 94836 3816152 ~ 3827361 (+)
CI01000092_03725440_03728304 NA coding upstream 193872 3723043 ~ 3728325 (+)
CI01000092_03693715_03694890 NA coding upstream 226969 3690550 ~ 3695228 (+)
CI01000092_03551674_03573437 NA coding upstream 348705 3551674 ~ 3573492 (+)
CI01000092_04205017_04213986 NA coding downstream 282573 4205017 ~ 4214128 (+)
CI01000092_04218446_04223477 NA coding downstream 296002 4218446 ~ 4224664 (+)
CI01000092_04284298_04291859 NA coding downstream 361854 4284298 ~ 4291859 (+)
CI01000092_04335830_04347365 MED17 coding downstream 413386 4335830 ~ 4347554 (+)
CI01000092_04355642_04374319 NA coding downstream 432421 4354865 ~ 4374322 (+)
G305666 NA non-coding upstream 232 3921032 ~ 3921965 (+)
G305665 NA non-coding upstream 3328 3918485 ~ 3918869 (+)
G305664 NA non-coding upstream 4511 3917332 ~ 3917686 (+)
G305663 NA non-coding upstream 11264 3909763 ~ 3910933 (+)
G305662 NA non-coding upstream 14832 3906990 ~ 3907365 (+)
G305668 NA non-coding downstream 247 3922691 ~ 3923720 (+)
G305669 NA non-coding downstream 1405 3923849 ~ 3925386 (+)
G305671 NA non-coding downstream 4743 3927187 ~ 3927426 (+)
G305672 NA non-coding downstream 5961 3928405 ~ 3928662 (+)
G305673 NA non-coding downstream 7037 3929481 ~ 3929838 (+)
G305596 NA other upstream 60864 3726347 ~ 3863135 (+)
G305584 NA other upstream 254232 3667308 ~ 3667965 (+)
G304938 NA other upstream 1603963 2317792 ~ 2318234 (+)
G303768 NA other upstream 2605674 1315443 ~ 1316523 (+)

Expression


G305667 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G305667 Expression in each Bioproject

Bar chart with 9 bars.
G305667 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1250.
End of interactive chart.

Co-expression Network