G306200


Basic Information

Item Value
gene id G306200
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000092
NCBI id null
chromosome length 5370156
location 4211608 ~ 4212050 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU347912
ATATAATTAGAATATCATCAAAAAGTTGATTTATTTCACTAATTCCATTCAAAAAAAGTGAAACTTGTATATTATATCAGTCTGTGTGTAATGAATGAATATATTTCAAATGTTTATTTCTTTTAATTTTGATGATTATAACTGACAACTAAGGAAAATCCCAAATTCAGTATCAGAAAATTAGAATATTACTTAAGACCAATACAAAGAAAGGATTTTTAGAAATCTTGGCCAACTGAAAAGTATGAACATGAAAAGTATGAGCATGTACAGCACTCAATACTTAGTTGGGGCTCCTTTTGCCTGAATTACTACAGCAATGCGGCATGGCATGGAGTCGATCAGTCTGTAGCACTGCTCAGGTGTTATAAGAGCCCAGGTTGCTCTGATAGTGGCCTTCAGCTCTTCTGCATTGTTGGGTCTGGCATATCGCATCTTCCTCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU347912 True 443 lncRNA 0.34 1 4211608 4212050

Neighbor

gene id symbol gene type direction distance location
CI01000092_03828205_03831437 NA coding upstream 379833 3828205 ~ 3831775 (+)
CI01000092_03816152_03827312 AXL coding upstream 384247 3816152 ~ 3827361 (+)
CI01000092_03725440_03728304 NA coding upstream 483283 3723043 ~ 3728325 (+)
CI01000092_03693715_03694890 NA coding upstream 516380 3690550 ~ 3695228 (+)
CI01000092_03551674_03573437 NA coding upstream 638116 3551674 ~ 3573492 (+)
CI01000092_04218446_04223477 NA coding downstream 6396 4218446 ~ 4224664 (+)
CI01000092_04284298_04291859 NA coding downstream 72248 4284298 ~ 4291859 (+)
CI01000092_04335830_04347365 MED17 coding downstream 123780 4335830 ~ 4347554 (+)
CI01000092_04355642_04374319 NA coding downstream 142815 4354865 ~ 4374322 (+)
CI01000092_04392184_04393522 NA coding downstream 179784 4391834 ~ 4393942 (+)
G306173 NA non-coding upstream 50174 4161047 ~ 4161434 (+)
G306165 NA non-coding upstream 58838 4152491 ~ 4152770 (+)
G306154 NA non-coding upstream 72922 4138435 ~ 4138686 (+)
G305734 NA non-coding upstream 110881 4100470 ~ 4100727 (+)
G305704 NA non-coding upstream 119819 4091538 ~ 4091789 (+)
G306217 NA non-coding downstream 91737 4303787 ~ 4304138 (+)
G306205 NA non-coding downstream 94739 4306789 ~ 4313604 (+)
G306241 NA non-coding downstream 159529 4371579 ~ 4372133 (+)
G306238 NA non-coding downstream 176774 4388824 ~ 4425428 (+)
G306252 NA non-coding downstream 184397 4396447 ~ 4396893 (+)
G305596 NA other upstream 350275 3726347 ~ 3863135 (+)
G305584 NA other upstream 543643 3667308 ~ 3667965 (+)
G304938 NA other upstream 1893374 2317792 ~ 2318234 (+)
G303768 NA other upstream 2895085 1315443 ~ 1316523 (+)

Expression


Co-expression Network