G308000



Basic Information


Item Value
gene id G308000
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000095
NCBI id null
chromosome length 6456983
location 30845 ~ 31109 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU350007
TATTCTCATTTGTTTCACTAGCCTATATGTACGGCCACAAGAGAAATAATGGAATAAATTAAGACAGTTATATACCGTTATCAGCATATTATGTTGAAATTCGTCTCTGAGAGAATATGCTCCGTTAATGCAGCGTCAGACAGCTCCGTCACATTTTACTTTCAATTTCTGTAGTGAATACTGACCGAGGTTGAGACTTTTTCACCGGCATAACTCTTGCGCAAAGTTTGCACATTGCTTCTTGTGTGATATCCATTGGCTCCCC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU350007 True 265 lncRNA 0.39 1 30845 31109

Neighbor


gene id symbol gene type direction distance location
CI01000095_00166019_00170944 NA coding upstream 134910 166019 ~ 170944 (-)
CI01000095_00170941_00172566 NA coding upstream 139832 170941 ~ 172566 (-)
CI01000095_00173095_00181309 NA coding upstream 141986 173095 ~ 181309 (-)
CI01000095_00183587_00185442 HMGB1B, HMGB1, HMGB1A coding upstream 152110 183219 ~ 186905 (-)
CI01000095_00219520_00237347 HSPH1 coding upstream 188327 219436 ~ 237432 (-)
G307996 NA non-coding downstream 2146 28364 ~ 28699 (-)
G308004 NA non-coding upstream 1315 32424 ~ 32702 (-)
G308017 NA non-coding upstream 13824 44933 ~ 45215 (-)
G308032 NA non-coding upstream 27257 58366 ~ 58575 (-)
G309253 NA non-coding upstream 45654 76763 ~ 77189 (-)
G309272 NA non-coding upstream 60533 91642 ~ 98251 (-)
G309626 NA other upstream 1054479 1085588 ~ 1088166 (-)
G309753 NA other upstream 1147488 1178597 ~ 1181758 (-)
G309815 NA other upstream 2632221 2663330 ~ 2731704 (-)
G310207 NA other upstream 3160989 3192098 ~ 3222668 (-)
CI01000095_03528759_03538412 NA other upstream 3499803 3528463 ~ 3539055 (-)

Expression



Co-expression Network