G309935



Basic Information


Item Value
gene id G309935
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000095
NCBI id null
chromosome length 6456983
location 1825647 ~ 1825921 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU352317
CTTTATTGGATGCCCGTGGTCTTTGGGCCCTCAGACGACACTGCATCACTCATCGGCATGATTGTGTCAATGACATTACTAAATGGGCCCAGGAATACTTCCAGAAACCACTGTCGGTAAACACAATCCGCCGTGCCATCTGCAGATGCCAACTAAAGCTCTATCATACAAAAAGGAAGCCATATGTGAACATGGTCCAGAAGCGCTGTCGTGTCCTGTGGGTCAAGGCTCATTTAAAATGGACTGTTTCAAAGTGGAAAAGTGTTCTATTGTCA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU352317 True 275 lncRNA 0.46 1 1825647 1825921

Neighbor


gene id symbol gene type direction distance location
CI01000095_01821436_01824400 MMP13B, MMP13 coding downstream 1233 1821210 ~ 1824414 (-)
CI01000095_01814503_01819719 NA coding downstream 5928 1814055 ~ 1819719 (-)
CI01000095_01762546_01807415 PDS5B coding downstream 18173 1762032 ~ 1807474 (-)
CI01000095_01753866_01754199 NA coding downstream 71448 1753845 ~ 1754199 (-)
CI01000095_01747706_01752312 NA coding downstream 73335 1747706 ~ 1752312 (-)
CI01000095_01922388_01929182 MAG coding upstream 95676 1921597 ~ 1929367 (-)
CI01000095_01952923_01958479 NA coding upstream 126593 1952514 ~ 1958479 (-)
CI01000095_01979835_01982124 VWDE coding upstream 153914 1979835 ~ 1982216 (-)
CI01000095_01983843_01999514 VWDE coding upstream 157913 1983834 ~ 1999514 (-)
CI01000095_02043972_02058964 NA coding upstream 217748 2043669 ~ 2059147 (-)
G309928 NA non-coding downstream 86424 1739018 ~ 1739223 (-)
G309809 NA non-coding downstream 209614 1614468 ~ 1616033 (-)
G309805 NA non-coding downstream 533640 1261954 ~ 1292007 (-)
G309622 NA non-coding downstream 690192 1096224 ~ 1135455 (-)
G309719 NA non-coding downstream 695197 1104785 ~ 1130450 (-)
G309947 NA non-coding upstream 28144 1854065 ~ 1854369 (-)
G309948 NA non-coding upstream 28732 1854653 ~ 1855158 (-)
G309934 NA non-coding upstream 35815 1861736 ~ 1893780 (-)
G309781 NA non-coding upstream 53138 1879059 ~ 1915282 (-)
G309958 NA non-coding upstream 70303 1896224 ~ 1901052 (-)
G309753 NA other downstream 643889 1178597 ~ 1181758 (-)
G309626 NA other downstream 737481 1085588 ~ 1088166 (-)
G309815 NA other upstream 837409 2663330 ~ 2731704 (-)
G310207 NA other upstream 1366177 3192098 ~ 3222668 (-)
CI01000095_03528759_03538412 NA other upstream 1704991 3528463 ~ 3539055 (-)
G311036 NA other upstream 2533740 4357325 ~ 4362626 (-)
G311701 NA other upstream 3323104 5149025 ~ 5154494 (-)

Expression



Co-expression Network