G309800


Basic Information

Item Value
gene id G309800
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000095
NCBI id null
chromosome length 6456983
location 1963378 ~ 1964554 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU352167
CTGCAATATAACAAAGAGTGAAAAATTTAAGGGGGTCTGAATACTTTCCGTACCCACTGTATATATATATACATACATACACAATTTTGATGTGAAATAGATATTCATACAAACTTACGTTCGTCTTGGCTTCAGTCTCTGGTCGCTGTATGGTATCAAAGCAACTAGCTGGTTTTCTTGGTCTGTGAGAATATCCAGGATAGGAAGTACACATAATTACAACAATGATTTATACAATTATTGATGCCCCTTCGTTAGAGAACAGTTTATTGATGTCAAAAATAGATTTGCATGTTACATTTTGTGGTACAAAGTAATGTGTAGATGGATGGCTGGAAGACAGATCTGTTCTTACCTCTTGGTATTCTCCCTGTCCCTTGACAAGTAGGACAGGTGACACTGTCTCTGCCTGTGAATTCAACATATGGAAACTCCTCTTTATCGTCCTCGGTGTGGGAATTTGAGTCTTCAGTCAGTTTCTCCTGGTCCTCTCTTTGCTTTGGTAAGGAAAACATAGACTTCCCCATGGTTAGGCCTGCCTTTTTTTGAAGGGTCCTGTCTTCTGTTTGTATAAAATAACAGTCGCTACAATGTCATTACTCCGTCGCGACCGTGTTGTTATTTTCCCCAACCTGAATCTCTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU352167 True 643 lncRNA 0.39 2 1963378 1964554

Neighbor

gene id symbol gene type direction distance location
CI01000095_01952923_01958479 NA coding downstream 4899 1952514 ~ 1958479 (-)
CI01000095_01922388_01929182 MAG coding downstream 34011 1921597 ~ 1929367 (-)
CI01000095_01821436_01824400 MMP13B, MMP13 coding downstream 138964 1821210 ~ 1824414 (-)
CI01000095_01814503_01819719 NA coding downstream 143659 1814055 ~ 1819719 (-)
CI01000095_01762546_01807415 PDS5B coding downstream 155904 1762032 ~ 1807474 (-)
CI01000095_01979835_01982124 VWDE coding upstream 15281 1979835 ~ 1982216 (-)
CI01000095_01983843_01999514 VWDE coding upstream 19280 1983834 ~ 1999514 (-)
CI01000095_02043972_02058964 NA coding upstream 79115 2043669 ~ 2059147 (-)
CI01000095_02066069_02074313 ETV1 coding upstream 101056 2065610 ~ 2074313 (-)
CI01000095_02108777_02148734 DGKB coding upstream 144223 2108777 ~ 2148734 (-)
G309801 NA non-coding downstream 1592 1960112 ~ 1961786 (-)
G309781 NA non-coding downstream 48096 1879059 ~ 1915282 (-)
G309958 NA non-coding downstream 62326 1896224 ~ 1901052 (-)
G309934 NA non-coding downstream 69598 1861736 ~ 1893780 (-)
G309948 NA non-coding downstream 108220 1854653 ~ 1855158 (-)
G309962 NA non-coding upstream 5384 1969938 ~ 1971216 (-)
G309981 NA non-coding upstream 47039 2011593 ~ 2014452 (-)
G310006 NA non-coding upstream 69530 2034084 ~ 2034581 (-)
G309825 NA non-coding upstream 365874 2330428 ~ 2337810 (-)
G309828 NA non-coding upstream 379831 2344385 ~ 2345941 (-)
G309753 NA other downstream 781620 1178597 ~ 1181758 (-)
G309626 NA other downstream 875212 1085588 ~ 1088166 (-)
G309815 NA other upstream 698776 2663330 ~ 2731704 (-)
G310207 NA other upstream 1227544 3192098 ~ 3222668 (-)
CI01000095_03528759_03538412 NA other upstream 1566358 3528463 ~ 3539055 (-)
G311036 NA other upstream 2395107 4357325 ~ 4362626 (-)
G311701 NA other upstream 3184471 5149025 ~ 5154494 (-)

Expression


Co-expression Network