G310321


Basic Information

Item Value
gene id G310321
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000095
NCBI id null
chromosome length 6456983
location 3229633 ~ 3229895 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU352791
CTGTTTAGTGCGATTGTTGAAACATCTGTTTCTCACTGTCTGGACTGCATAGGTTCACAACATTTTTGGTAACCCACTTTCTATTAGCATGCACATAGCCATGTCAAATAAGGTTCTCCAGTTTCGTTTAGCTGTGCTGTTTTGGTGTGGAGAGTATGGTGCTGATGTCTTCTACTTAATAACGCTTGGTACTCTCTTCCTGTGAACTCTGTACCATTGTCAGACCTGATGCACTTAATTTTTCCATATGGAGCCATGTCAGC

Function

NR:

description
PREDICTED: cbp/p300-interacting transactivator 2

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU352791 True 263 lncRNA 0.42 1 3229633 3229895

Neighbor

gene id symbol gene type direction distance location
CI01000095_03169563_03175213 IRS1 coding downstream 53035 3169539 ~ 3176598 (-)
CI01000095_03149700_03152493 NA coding downstream 76787 3147397 ~ 3152846 (-)
CI01000095_03034508_03067922 NA coding downstream 160447 3034270 ~ 3069186 (-)
CI01000095_02947521_02950293 NA coding downstream 277971 2947013 ~ 2951662 (-)
CI01000095_02829083_02852606 MECOM coding downstream 377027 2827729 ~ 2852606 (-)
CI01000095_03249415_03287084 NA coding upstream 19520 3249415 ~ 3287084 (-)
CI01000095_03431721_03434234 NA coding upstream 201805 3431700 ~ 3435196 (-)
CI01000095_03485842_03499188 NA coding upstream 255909 3485804 ~ 3501925 (-)
CI01000095_03508757_03510876 NA coding upstream 278768 3508663 ~ 3510966 (-)
CI01000095_03511710_03521880 NA coding upstream 281242 3511137 ~ 3521945 (-)
G310207 NA non-coding downstream 6965 3192098 ~ 3222668 (-)
G310215 NA non-coding downstream 49847 3179088 ~ 3179786 (-)
G310293 NA non-coding downstream 100108 3129195 ~ 3129525 (-)
G310322 NA non-coding upstream 2212 3232107 ~ 3232332 (-)
G310319 NA non-coding upstream 6106 3236001 ~ 3237499 (-)
G310384 NA non-coding upstream 141911 3371806 ~ 3372006 (-)
G310385 NA non-coding upstream 144537 3374432 ~ 3374849 (-)
G310759 NA non-coding upstream 252535 3482430 ~ 3482631 (-)
G309815 NA other downstream 497929 2663330 ~ 2731704 (-)
G309753 NA other downstream 2047875 1178597 ~ 1181758 (-)
G309626 NA other downstream 2141467 1085588 ~ 1088166 (-)
CI01000095_03528759_03538412 NA other upstream 301017 3528463 ~ 3539055 (-)
G311036 NA other upstream 1129766 4357325 ~ 4362626 (-)
G311701 NA other upstream 1919130 5149025 ~ 5154494 (-)
CI01000095_05211660_05234474 NA other upstream 1953698 5211587 ~ 5237234 (-)
CI01000095_05604829_05607020 NA other upstream 2376318 5603542 ~ 5607020 (-)

Expression


Co-expression Network