G310385


Basic Information

Item Value
gene id G310385
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000095
NCBI id null
chromosome length 6456983
location 3374432 ~ 3374849 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU352863
GAAGAGCTGAAGGCCACTATCAGAGCAACCTGGGCTCTTATAACACCTGAGCAGTGCCACAGACTGATCGACTCTATGCCACGCCGCATTGCTGCAGTAATTCAGGCAAAAGGAGCCCCAACTAAGTATTGAGTGCTGTACATGCTCATACTTTTCATGTTCATACTTTTCAGTTGGCCAAGATTTCTAAAAATCCTTTCTTTGTATTGGTCTTAAGTAATATTCTAATTTTCTGAGATACTGAATTTGGAATTTTCCTTAGTTGTCAGTTATAATCATCAAAATTAAAAGAAATAAACATTTGAAATATATCAGTCTGTGTGTAATGAATGAATATAATATACAAGTTTCACTTTTTGAATGGAATTAGTGAAATAAATCAACATTTTGATGATATTCTAATTATATGACCAGCACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU352863 True 418 lncRNA 0.34 1 3374432 3374849

Neighbor

gene id symbol gene type direction distance location
CI01000095_03249415_03287084 NA coding downstream 87348 3249415 ~ 3287084 (-)
CI01000095_03169563_03175213 IRS1 coding downstream 197834 3169539 ~ 3176598 (-)
CI01000095_03149700_03152493 NA coding downstream 221586 3147397 ~ 3152846 (-)
CI01000095_03034508_03067922 NA coding downstream 305246 3034270 ~ 3069186 (-)
CI01000095_02947521_02950293 NA coding downstream 422770 2947013 ~ 2951662 (-)
CI01000095_03431721_03434234 NA coding upstream 56851 3431700 ~ 3435196 (-)
CI01000095_03485842_03499188 NA coding upstream 110955 3485804 ~ 3501925 (-)
CI01000095_03508757_03510876 NA coding upstream 133814 3508663 ~ 3510966 (-)
CI01000095_03511710_03521880 NA coding upstream 136288 3511137 ~ 3521945 (-)
CI01000095_03528759_03538412 NA coding upstream 153614 3528463 ~ 3539055 (-)
G310384 NA non-coding downstream 2426 3371806 ~ 3372006 (-)
G310319 NA non-coding downstream 136933 3236001 ~ 3237499 (-)
G310322 NA non-coding downstream 142100 3232107 ~ 3232332 (-)
G310321 NA non-coding downstream 144537 3229633 ~ 3229895 (-)
G310207 NA non-coding downstream 151764 3192098 ~ 3222668 (-)
G310759 NA non-coding upstream 107581 3482430 ~ 3482631 (-)
G310777 NA non-coding upstream 198771 3573620 ~ 3641059 (-)
G310782 NA non-coding upstream 209528 3584377 ~ 3590766 (-)
G310857 NA non-coding upstream 507965 3882814 ~ 3882971 (-)
G310862 NA non-coding upstream 517509 3892358 ~ 3892703 (-)
G309815 NA other downstream 642728 2663330 ~ 2731704 (-)
G309753 NA other downstream 2192674 1178597 ~ 1181758 (-)
G309626 NA other downstream 2286266 1085588 ~ 1088166 (-)
G311036 NA other upstream 984812 4357325 ~ 4362626 (-)
G311701 NA other upstream 1774176 5149025 ~ 5154494 (-)
CI01000095_05211660_05234474 NA other upstream 1808744 5211587 ~ 5237234 (-)
CI01000095_05604829_05607020 NA other upstream 2231364 5603542 ~ 5607020 (-)

Expression


Co-expression Network