G310759


Basic Information

Item Value
gene id G310759
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000095
NCBI id null
chromosome length 6456983
location 3482430 ~ 3482631 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU353288
CATGTTGGTGCTTCTTCTCTTCAGTTCACTCCACTCATTTTCTTTAGGGTTCAGGTCAGGGGACTGGGACGACCATGGCAGAAGCTTCATTTTGTGCTCAGTGACACATTTTTGTGTTGGTTTTGATGTTTGTTTTGGATCATTGTCCTGATGGAAGATCCAACCACGGTCCATTATTGAATTTCTAGCAGAAGCGGTCAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU353288 True 202 lncRNA 0.45 1 3482430 3482631

Neighbor

gene id symbol gene type direction distance location
CI01000095_03431721_03434234 NA coding downstream 47234 3431700 ~ 3435196 (-)
CI01000095_03249415_03287084 NA coding downstream 195346 3249415 ~ 3287084 (-)
CI01000095_03169563_03175213 IRS1 coding downstream 305832 3169539 ~ 3176598 (-)
CI01000095_03149700_03152493 NA coding downstream 329584 3147397 ~ 3152846 (-)
CI01000095_03034508_03067922 NA coding downstream 413244 3034270 ~ 3069186 (-)
CI01000095_03485842_03499188 NA coding upstream 3173 3485804 ~ 3501925 (-)
CI01000095_03508757_03510876 NA coding upstream 26032 3508663 ~ 3510966 (-)
CI01000095_03511710_03521880 NA coding upstream 28506 3511137 ~ 3521945 (-)
CI01000095_03528759_03538412 NA coding upstream 45832 3528463 ~ 3539055 (-)
CI01000095_03544585_03545168 NA coding upstream 61820 3544451 ~ 3545407 (-)
G310385 NA non-coding downstream 107581 3374432 ~ 3374849 (-)
G310384 NA non-coding downstream 110424 3371806 ~ 3372006 (-)
G310319 NA non-coding downstream 244931 3236001 ~ 3237499 (-)
G310322 NA non-coding downstream 250098 3232107 ~ 3232332 (-)
G310321 NA non-coding downstream 252535 3229633 ~ 3229895 (-)
G310777 NA non-coding upstream 90989 3573620 ~ 3641059 (-)
G310782 NA non-coding upstream 101746 3584377 ~ 3590766 (-)
G310857 NA non-coding upstream 400183 3882814 ~ 3882971 (-)
G310862 NA non-coding upstream 409727 3892358 ~ 3892703 (-)
G310918 NA non-coding upstream 512765 3995396 ~ 3995706 (-)
G310207 NA other downstream 259762 3192098 ~ 3222668 (-)
G309815 NA other downstream 750726 2663330 ~ 2731704 (-)
G309753 NA other downstream 2300672 1178597 ~ 1181758 (-)
G309626 NA other downstream 2394264 1085588 ~ 1088166 (-)
G311036 NA other upstream 877030 4357325 ~ 4362626 (-)
G311701 NA other upstream 1666394 5149025 ~ 5154494 (-)
CI01000095_05211660_05234474 NA other upstream 1700962 5211587 ~ 5237234 (-)
CI01000095_05604829_05607020 NA other upstream 2123582 5603542 ~ 5607020 (-)

Expression


Co-expression Network