G310777


Basic Information

Item Value
gene id G310777
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000095
NCBI id null
chromosome length 6456983
location 3573620 ~ 3641059 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU353308
ACAAATTTAAGAATCTGTTTAAGATCTGCTGATCCTACATCCTGACATAACCTCACATGAAATACTAAGGTGAAGTATATTGTATTTAACATTTTGAGGTAAAGATAATGACAAAGTAAGGAGATCAAGGCAGGCAGCCCAGGTGTCTGTAACATTAACCTTTTGTCTTCATGCACTTCCTGACCATTTGGCAGGACAAGCTCAAGATACAGCGGTGCCTTTGTCTCTATGATAATGTAAAGGTATGGGCGATACTGTCAGACTGATTGGATTAGCACCTATGCATTTGAATGACACCGTTATGCTGATTAGATCATGGCTGGGAAATGTAGGGAATGGGCTGATTCCTGCACTGCATTTGCATGCTTTGTTTAGATTGTCTCCACCTCTACTCTAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU353308 True 397 lncRNA 0.40 2 3573620 3641059

Neighbor

gene id symbol gene type direction distance location
CI01000095_03554228_03557044 NA coding downstream 16443 3554188 ~ 3557177 (-)
CI01000095_03544585_03545168 NA coding downstream 28213 3544451 ~ 3545407 (-)
CI01000095_03528759_03538412 NA coding downstream 34565 3528463 ~ 3539055 (-)
CI01000095_03511710_03521880 NA coding downstream 51675 3511137 ~ 3521945 (-)
CI01000095_03508757_03510876 NA coding downstream 62654 3508663 ~ 3510966 (-)
CI01000095_03645380_03674104 NA coding upstream 4220 3645279 ~ 3674220 (-)
CI01000095_03720995_03743990 NA coding upstream 79494 3720553 ~ 3744162 (-)
CI01000095_03763628_03856780 NA coding upstream 121891 3762950 ~ 3856780 (-)
CI01000095_03937755_03971616 NA coding upstream 294958 3936017 ~ 3972420 (-)
CI01000095_04055806_04081892 NA coding upstream 414503 4055562 ~ 4081892 (-)
G310759 NA non-coding downstream 90989 3482430 ~ 3482631 (-)
G310385 NA non-coding downstream 198771 3374432 ~ 3374849 (-)
G310384 NA non-coding downstream 201614 3371806 ~ 3372006 (-)
G310319 NA non-coding downstream 336121 3236001 ~ 3237499 (-)
G310322 NA non-coding downstream 341288 3232107 ~ 3232332 (-)
G310857 NA non-coding upstream 241755 3882814 ~ 3882971 (-)
G310862 NA non-coding upstream 251299 3892358 ~ 3892703 (-)
G310918 NA non-coding upstream 354337 3995396 ~ 3995706 (-)
G310884 NA non-coding upstream 406577 4047636 ~ 4049370 (-)
G310976 NA non-coding upstream 465044 4106103 ~ 4108125 (-)
G310207 NA other downstream 350952 3192098 ~ 3222668 (-)
G309815 NA other downstream 841916 2663330 ~ 2731704 (-)
G309753 NA other downstream 2391862 1178597 ~ 1181758 (-)
G309626 NA other downstream 2485454 1085588 ~ 1088166 (-)
G311036 NA other upstream 718602 4357325 ~ 4362626 (-)
G311701 NA other upstream 1507966 5149025 ~ 5154494 (-)
CI01000095_05211660_05234474 NA other upstream 1542534 5211587 ~ 5237234 (-)
CI01000095_05604829_05607020 NA other upstream 1965154 5603542 ~ 5607020 (-)
G312335 NA other upstream 2593326 6234385 ~ 6237845 (-)

Expression


Co-expression Network