G310968


Basic Information

Item Value
gene id G310968
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000095
NCBI id null
chromosome length 6456983
location 4221773 ~ 4222182 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU353507
TGGATTCTCTCTGCTGATTCATCTGTGACATTATTGTGACTCAGGCTATAAGAAGAAATGAGACAGAAACAATAAAATGACAGAAATAAACATAAGTTTGAATAAAGAGTTTCTCTGTTCCTGCCGTGTCTCTGTAACTCACTCCAAAGTCTGAGTTTTGTGCAGATGCGGCAGCAGCGGCTTCATGCAGTCGTCAGTGAGTTTACAGTGACTGAGATCCAGTTCTTTCAGCCCTTCAGAATATTCCAGAAACAGCGCCAGCTGTTCACAAGCGCTCTGGTCCATCTGAGTGTGACTGAGGTCCATCTCTCCTCCCAAAGCCTGTGAAAGAGCCTCAGTCCTCCTCAAAGAGCCTTTCTGAGATCCACCTTTACTAATACAAGCCAGAAACTGCAGCAGCAGAGCTTTAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU353507 True 410 lncRNA 0.45 1 4221773 4222182

Neighbor

gene id symbol gene type direction distance location
CI01000095_04055806_04081892 NA coding downstream 139881 4055562 ~ 4081892 (-)
CI01000095_03937755_03971616 NA coding downstream 249353 3936017 ~ 3972420 (-)
CI01000095_03763628_03856780 NA coding downstream 364993 3762950 ~ 3856780 (-)
CI01000095_03720995_03743990 NA coding downstream 477611 3720553 ~ 3744162 (-)
CI01000095_03645380_03674104 NA coding downstream 547553 3645279 ~ 3674220 (-)
CI01000095_04255180_04256500 MON1A coding upstream 32947 4255129 ~ 4256500 (-)
CI01000095_04262102_04292135 NGEF coding upstream 39613 4261795 ~ 4292135 (-)
CI01000095_04320760_04332337 ITM2CA coding upstream 97060 4319242 ~ 4332443 (-)
CI01000095_04332781_04341944 CAB39L, CAB39L.L, CAB39, CAB39.L coding upstream 110577 4332759 ~ 4344968 (-)
CI01000095_04829891_04901481 ROBO2 coding upstream 607709 4829891 ~ 4901481 (-)
G311011 NA non-coding downstream 1747 4219454 ~ 4220026 (-)
G310999 NA non-coding downstream 42209 4179182 ~ 4179564 (-)
G310982 NA non-coding downstream 94753 4123556 ~ 4127020 (-)
G310976 NA non-coding downstream 113648 4106103 ~ 4108125 (-)
G310884 NA non-coding downstream 172403 4047636 ~ 4049370 (-)
G310969 NA non-coding upstream 19748 4241930 ~ 4245095 (-)
G311021 NA non-coding upstream 32226 4254408 ~ 4254609 (-)
G311023 NA non-coding upstream 36135 4258317 ~ 4258593 (-)
G310967 NA non-coding upstream 90759 4312941 ~ 4316939 (-)
CI01000095_03528759_03538412 NA other downstream 684540 3528463 ~ 3539055 (-)
G310207 NA other downstream 999105 3192098 ~ 3222668 (-)
G309815 NA other downstream 1490069 2663330 ~ 2731704 (-)
G309753 NA other downstream 3040015 1178597 ~ 1181758 (-)
G309626 NA other downstream 3133607 1085588 ~ 1088166 (-)
G311036 NA other upstream 137479 4357325 ~ 4362626 (-)
G311701 NA other upstream 926843 5149025 ~ 5154494 (-)
CI01000095_05211660_05234474 NA other upstream 961411 5211587 ~ 5237234 (-)
CI01000095_05604829_05607020 NA other upstream 1384031 5603542 ~ 5607020 (-)
G312335 NA other upstream 2012203 6234385 ~ 6237845 (-)

Expression


Co-expression Network