G311895


Basic Information

Item Value
gene id G311895
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000095
NCBI id null
chromosome length 6456983
location 5502848 ~ 5503067 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU354573
TGACGCTGTTCACGTGAGCAGCATGTCAAGATGCGTGTCATGCCGACGCAGGAGCCGGCCAATACTGAGGCGCCGTTCTGATGTAGAACCCAGAAGTGCTGCACTGTGTTTAGTACGTGAACAGCATAGGAGACTGACATGGAAGAGAAGAAATTGTTGAATAAAGTCATTATTTTTATTTGTTTTTTGCACACAAATAGTATTCTTGCCACTTCATAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU354573 True 220 lncRNA 0.44 1 5502848 5503067

Neighbor

gene id symbol gene type direction distance location
CI01000095_05378348_05413679 STIM1, STIM1A coding downstream 89169 5377026 ~ 5413679 (-)
CI01000095_05357475_05373425 SEL1L3 coding downstream 129423 5355914 ~ 5373425 (-)
CI01000095_05211660_05234474 NA coding downstream 267718 5211587 ~ 5237234 (-)
CI01000095_05039659_05041786 NA coding downstream 460148 5039519 ~ 5042700 (-)
CI01000095_05017627_05022990 ROBO1, ROBO3, ROBO2 coding downstream 479858 5017363 ~ 5022990 (-)
CI01000095_05538915_05541548 NA coding upstream 35540 5538607 ~ 5543317 (-)
CI01000095_05555392_05575055 NA coding upstream 52021 5555088 ~ 5575067 (-)
CI01000095_05587464_05588898 NA coding upstream 84354 5587421 ~ 5589744 (-)
CI01000095_05604829_05607020 NA coding upstream 100475 5603542 ~ 5607020 (-)
CI01000095_05637467_05689858 NA coding upstream 134341 5637408 ~ 5689858 (-)
G311882 NA non-coding downstream 15269 5486331 ~ 5487579 (-)
G311880 NA non-coding downstream 26082 5476441 ~ 5476766 (-)
G311862 NA non-coding downstream 60575 5403961 ~ 5442273 (-)
G311861 NA non-coding downstream 101343 5396343 ~ 5401505 (-)
G311851 NA non-coding downstream 119646 5336322 ~ 5383202 (-)
G311684 NA non-coding upstream 3742 5506809 ~ 5509844 (-)
G311902 NA non-coding upstream 42807 5545874 ~ 5546097 (-)
G311903 NA non-coding upstream 44837 5547904 ~ 5599693 (-)
G311919 NA non-coding upstream 75456 5578523 ~ 5579197 (-)
G311939 NA non-coding upstream 111300 5614367 ~ 5616738 (-)
G311701 NA other downstream 348354 5149025 ~ 5154494 (-)
G311036 NA other downstream 1140222 4357325 ~ 4362626 (-)
CI01000095_03528759_03538412 NA other downstream 1965615 3528463 ~ 3539055 (-)
G310207 NA other downstream 2280180 3192098 ~ 3222668 (-)
G312335 NA other upstream 731318 6234385 ~ 6237845 (-)
G312368 NA other upstream 776526 6279593 ~ 6280086 (-)
CI01000095_06414966_06435096 NA other upstream 910025 6414966 ~ 6435359 (-)
CI01000095_06438476_06449339 USP16 other upstream 934365 6437432 ~ 6449342 (-)

Expression


Co-expression Network