G322787



Basic Information


Item Value
gene id G322787
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000110
NCBI id null
chromosome length 4324856
location 717591 ~ 717822 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU367002
TGCAGCCTCTAACGCCAGTCGCTAGTGCGTGTCTTGAGGCAAGGGGATTGAGGTTTATCTGCACAGCTCTTACTAGCTGGCCTCCGTTACAACTCACCCCCGTAAACCTCACTCCCATCCGGGTCATAGCACCAATGTAACCCCTCAGATCCTACTTGCCCTGCTTTGTGCCGGCCTCGAACCCGGGTCTCCGGCGTGGGAGGCGGGTGCGCTAACAAGGAGGCTAAAGACT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU367002 True 232 lncRNA 0.58 1 717591 717822

Neighbor


gene id symbol gene type direction distance location
CI01000110_00485210_00497592 AUP1 coding downstream 219736 485210 ~ 497855 (-)
CI01000110_00479846_00482461 TUBB4A.S, MGC53997, TUBB4B, TUBB4A, TUBB4B.L, TUBB, TBB2C, TUBB2B coding downstream 233594 479710 ~ 483997 (-)
CI01000110_00407073_00438547 KCTD8 coding downstream 278591 406504 ~ 439000 (-)
CI01000110_00326156_00333256 NA coding downstream 382930 325855 ~ 334661 (-)
CI01000110_00319793_00324629 NA coding downstream 392962 319692 ~ 324629 (-)
CI01000110_00749362_00764862 NA coding upstream 31081 748903 ~ 764948 (-)
CI01000110_00779093_00781105 LBX2 coding upstream 60752 778574 ~ 781656 (-)
CI01000110_00929399_00931607 NANOS1, NANO1 coding upstream 211324 929146 ~ 931725 (-)
CI01000110_01112020_01115441 NA coding upstream 394104 1111926 ~ 1115582 (-)
CI01000110_01126191_01127662 NA coding upstream 408013 1125835 ~ 1127662 (-)
G322786 NA non-coding downstream 2434 714958 ~ 715157 (-)
G322779 NA non-coding downstream 15122 702232 ~ 702469 (-)
G322758 NA non-coding downstream 39921 677438 ~ 677670 (-)
G322756 NA non-coding downstream 47038 670331 ~ 670553 (-)
G322714 NA non-coding downstream 58820 657953 ~ 658771 (-)
G322761 NA non-coding upstream 49171 766993 ~ 770326 (-)
G323048 NA non-coding upstream 267254 985076 ~ 1134588 (-)
G323107 NA non-coding upstream 428293 1146115 ~ 1146378 (-)
G323110 NA non-coding upstream 432045 1149867 ~ 1150154 (-)
G323124 NA non-coding upstream 457038 1174860 ~ 1175081 (-)
G322580 NA other downstream 611772 103265 ~ 105819 (-)
G323133 NA other upstream 488007 1205829 ~ 1236849 (-)
G324936 NA other upstream 2397636 3013673 ~ 3120099 (-)

Expression



Co-expression Network