G323125



Basic Information


Item Value
gene id G323125
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000110
NCBI id null
chromosome length 4324856
location 1175311 ~ 1175517 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU367420
TTGGTGCATAGATAGTCTCTTCTTCTGCTGCTCTTTTTTCCTGTTGTGGCGGTTAGCAAACAGCATTGCATTACCACATGCGCCCCCTTCTGGATTGGAGTGTGGATCACCTATGACTGACTGTATTCGTCGTCTGACTGTATGCACCAAACCATGACGTCCGTACTGCGACAGTTCAGGATGAATACATGTACCGTTACACCCCTA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU367420 True 207 lncRNA 0.48 1 1175311 1175517

Neighbor


gene id symbol gene type direction distance location
CI01000110_01135230_01139236 AP1AR coding downstream 36075 1135131 ~ 1139236 (-)
CI01000110_01126191_01127662 NA coding downstream 47649 1125835 ~ 1127662 (-)
CI01000110_01112020_01115441 NA coding downstream 59729 1111926 ~ 1115582 (-)
CI01000110_00929399_00931607 NANOS1, NANO1 coding downstream 243586 929146 ~ 931725 (-)
CI01000110_00779093_00781105 LBX2 coding downstream 393655 778574 ~ 781656 (-)
CI01000110_01422600_01428949 SELT2 coding upstream 246376 1421628 ~ 1428949 (-)
CI01000110_01432049_01434499 RAB33A coding upstream 256188 1431705 ~ 1434499 (-)
CI01000110_01436253_01450759 NA coding upstream 260688 1436205 ~ 1450759 (-)
CI01000110_01864492_01865547 NA coding upstream 688961 1864478 ~ 1865547 (-)
CI01000110_01988105_01990600 SLITRK4 coding upstream 811072 1986589 ~ 1991741 (-)
G323124 NA non-coding downstream 230 1174860 ~ 1175081 (-)
G323110 NA non-coding downstream 25157 1149867 ~ 1150154 (-)
G323107 NA non-coding downstream 28933 1146115 ~ 1146378 (-)
G323048 NA non-coding downstream 40723 985076 ~ 1134588 (-)
G322761 NA non-coding downstream 404985 766993 ~ 770326 (-)
G323149 NA non-coding upstream 68332 1243849 ~ 1250080 (-)
G323274 NA non-coding upstream 106529 1282046 ~ 1347313 (-)
G323322 NA non-coding upstream 190142 1365659 ~ 1443509 (-)
G323342 NA non-coding upstream 243829 1419346 ~ 1419646 (-)
G322580 NA other downstream 1069492 103265 ~ 105819 (-)
G323133 NA other upstream 30312 1205829 ~ 1236849 (-)
G324936 NA other upstream 1939941 3013673 ~ 3120099 (-)

Expression



Co-expression Network