G323388



Basic Information


Item Value
gene id G323388
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000110
NCBI id null
chromosome length 4324856
location 1519759 ~ 1520020 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU367702
GGGGTAGTCGTGGCCTAATGGTTAGAGAGTCAGACTGGTAACCCGAAGGTTGCGGGTTTGATTCTCAATACCGGTGGGAAATTACTCAGTGATCTTGAACAAGACACCTAACTCCCAATCGCTCCCTGAGTGCCACAGCCAAAATGGCTGCCCATTGCTCTGGGTGTGCGTGTGCACTAACTGGATGGGTTAAATGCAGAGGACAAATTCCGAGTACCATACATGGGTTACCATACTTGGCCTTCACATGTCACAGAAAATG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU367702 True 262 lncRNA 0.49 1 1519759 1520020

Neighbor


gene id symbol gene type direction distance location
CI01000110_01436253_01450759 NA coding downstream 69000 1436205 ~ 1450759 (-)
CI01000110_01432049_01434499 RAB33A coding downstream 85260 1431705 ~ 1434499 (-)
CI01000110_01422600_01428949 SELT2 coding downstream 90810 1421628 ~ 1428949 (-)
CI01000110_01135230_01139236 AP1AR coding downstream 380523 1135131 ~ 1139236 (-)
CI01000110_01126191_01127662 NA coding downstream 392097 1125835 ~ 1127662 (-)
CI01000110_01864492_01865547 NA coding upstream 344458 1864478 ~ 1865547 (-)
CI01000110_01988105_01990600 SLITRK4 coding upstream 466569 1986589 ~ 1991741 (-)
CI01000110_02794268_02794597 NA coding upstream 1274162 2794182 ~ 2794597 (-)
CI01000110_02890041_02906679 NA coding upstream 1369940 2889879 ~ 2908219 (-)
CI01000110_03015589_03024689 IDS coding upstream 1495230 3015250 ~ 3025361 (-)
G323346 NA non-coding downstream 63068 1456412 ~ 1456691 (-)
G323322 NA non-coding downstream 76250 1365659 ~ 1443509 (-)
G323342 NA non-coding downstream 100113 1419346 ~ 1419646 (-)
G323274 NA non-coding downstream 172446 1282046 ~ 1347313 (-)
G323395 NA non-coding upstream 15564 1535584 ~ 1536004 (-)
G323559 NA non-coding upstream 234529 1754549 ~ 1754759 (-)
G323581 NA non-coding upstream 260979 1780999 ~ 1781243 (-)
G323722 NA non-coding upstream 305275 1825295 ~ 1825512 (-)
G323748 NA non-coding upstream 333071 1853091 ~ 1853302 (-)
G323133 NA other downstream 282910 1205829 ~ 1236849 (-)
G322580 NA other downstream 1413940 103265 ~ 105819 (-)
G324936 NA other upstream 1595438 3013673 ~ 3120099 (-)

Expression



Co-expression Network