G323969


Basic Information

Item Value
gene id G323969
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000110
NCBI id null
chromosome length 4324856
location 2170762 ~ 2170983 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU368336
GTGCTCTCGTTCAGCTAAGAAGGAGTTTTAATTAATAGCATCAACAAATCAGCTCTCAGACACTGCCACAATGTCAAGTAAAGAGAAGGTGTTGTCATGGTAACAGGCTATGCCAATAATGTATTCCTGAGGCTGAAGGAAAAGGAGGAAAAATATATAATGCGGCAATCAAGCACGTCAAGTCCGACCTATGCAGTGGCCGTCTGTTTGCGTTCACAGAGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU368336 True 222 lncRNA 0.44 1 2170762 2170983

Neighbor

gene id symbol gene type direction distance location
CI01000110_01988105_01990600 SLITRK4 coding downstream 179021 1986589 ~ 1991741 (-)
CI01000110_01864492_01865547 NA coding downstream 305215 1864478 ~ 1865547 (-)
CI01000110_01436253_01450759 NA coding downstream 720003 1436205 ~ 1450759 (-)
CI01000110_01432049_01434499 RAB33A coding downstream 736263 1431705 ~ 1434499 (-)
CI01000110_01422600_01428949 SELT2 coding downstream 741813 1421628 ~ 1428949 (-)
CI01000110_02794268_02794597 NA coding upstream 623199 2794182 ~ 2794597 (-)
CI01000110_02890041_02906679 NA coding upstream 718977 2889879 ~ 2908219 (-)
CI01000110_03015589_03024689 IDS coding upstream 844267 3015250 ~ 3025361 (-)
CI01000110_03084686_03087106 NA coding upstream 913456 3084439 ~ 3087106 (-)
CI01000110_03095980_03103572 RNF20 coding upstream 924473 3095456 ~ 3103572 (-)
G323965 NA non-coding downstream 18915 2151626 ~ 2151847 (-)
G323962 NA non-coding downstream 28691 2141605 ~ 2142071 (-)
G323827 NA non-coding downstream 77044 2093511 ~ 2093718 (-)
G323748 NA non-coding downstream 317460 1853091 ~ 1853302 (-)
G323722 NA non-coding downstream 345250 1825295 ~ 1825512 (-)
G323975 NA non-coding upstream 13672 2184655 ~ 2184892 (-)
G323983 NA non-coding upstream 23585 2194568 ~ 2194827 (-)
G323985 NA non-coding upstream 30102 2201085 ~ 2201412 (-)
G323987 NA non-coding upstream 32728 2203711 ~ 2206449 (-)
G323946 NA non-coding upstream 62213 2233196 ~ 2308545 (-)
G323133 NA other downstream 933913 1205829 ~ 1236849 (-)
G322580 NA other downstream 2064943 103265 ~ 105819 (-)
G324936 NA other upstream 944475 3013673 ~ 3120099 (-)

Expression


Co-expression Network