G325019


Basic Information

Item Value
gene id G325019
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000110
NCBI id null
chromosome length 4324856
location 3143516 ~ 3143879 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU369459
AGACAAAGCAGAACTGTTCGTCTCCACGCAACACACAGCAGTGTTTCATTTCTGAATCTGCGTTTTGAATGTAACAAAAGTGATTCAGCGGACCATTCATAAAAGACTTGAAGCGGCGCTACACGCAGACCGACCGGTGTATGACACCAAAGACTTACAGTGATATAGGTTACGCTTACCAATTTCTTGTTATCCACATGGACATCGATGTCCTCATTTTAAGACACTGTTTTTCATTTTCATTTTCTTTTTTGCGTTTTCTGTTTTCTGTTCTGCGCCCCAGAAACGCTTCCCTCCTCTGTCCATTTTGGACATGTGACTTTCCGTAACAGAGCAACGGCTCTTGTCGAAATGGTGAGCAGTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU369459 True 364 lncRNA 0.43 1 3143516 3143879

Neighbor

gene id symbol gene type direction distance location
CI01000110_03138199_03142034 NA coding downstream 1162 3137280 ~ 3142354 (-)
CI01000110_03122088_03123095 NA coding downstream 20421 3121663 ~ 3123095 (-)
CI01000110_03095980_03103572 RNF20 coding downstream 39944 3095456 ~ 3103572 (-)
CI01000110_03084686_03087106 NA coding downstream 56410 3084439 ~ 3087106 (-)
CI01000110_03015589_03024689 IDS coding downstream 118155 3015250 ~ 3025361 (-)
CI01000110_03152754_03157924 MAEA, MAEA.S coding upstream 8586 3152465 ~ 3157924 (-)
CI01000110_03196898_03206968 PPP2R2C coding upstream 52303 3196182 ~ 3206968 (-)
CI01000110_03220300_03222003 NA coding upstream 75941 3219820 ~ 3222003 (-)
CI01000110_03281209_03283417 EGR1 coding upstream 135883 3279762 ~ 3283849 (-)
CI01000110_03438821_03442595 NA coding upstream 294894 3438773 ~ 3442661 (-)
G325013 NA non-coding downstream 17670 3125408 ~ 3125846 (-)
G324936 NA non-coding downstream 23417 3013673 ~ 3120099 (-)
G324960 NA non-coding downstream 110050 3027257 ~ 3033466 (-)
G324939 NA non-coding downstream 111497 3031014 ~ 3032019 (-)
G324909 NA non-coding downstream 183679 2953232 ~ 2959837 (-)
G325020 NA non-coding upstream 53 3143932 ~ 3144335 (-)
G324978 NA non-coding upstream 3641 3147520 ~ 3200136 (-)
G325046 NA non-coding upstream 114829 3258708 ~ 3258939 (-)
G325047 NA non-coding upstream 115109 3258988 ~ 3259209 (-)
G324966 NA non-coding upstream 135168 3279047 ~ 3279429 (-)
G323133 NA other downstream 1906667 1205829 ~ 1236849 (-)
G322580 NA other downstream 3037697 103265 ~ 105819 (-)

Expression


Co-expression Network