G327893


Basic Information

Item Value
gene id G327893
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000112
NCBI id null
chromosome length 5247617
location 679232 ~ 679470 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU372690
GATTCAGTTCGCCTGGCGTCCCCCAGTGTTCAGGGGTGTCCATTACACTCGTGTGTCCCTGGACAATGCACCTGTTCTCCGGGCAGGGATTGCTGTCCTCCTGGCAAAGGATGCAATCGAGCCGGTCCCTCCAGCCGATATGGAGTCAGGGTTCTCCAGCCCCTACTTCATTGTACCCAAGAAGGGCGGTGGGCTACGGCCAATCCTGGATCTGCGTGTCCTGAATCGGTCTCTTCACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU372690 True 239 lncRNA 0.58 1 679232 679470

Neighbor

gene id symbol gene type direction distance location
CI01000112_00672164_00673174 PPP1R27, PPP1R27B coding upstream 5350 671939 ~ 673882 (+)
CI01000112_00655682_00669456 P4HB coding upstream 9284 654779 ~ 669948 (+)
CI01000112_00627027_00637276 NA coding upstream 41956 627027 ~ 637276 (+)
CI01000112_00379383_00617969 RPTOR coding upstream 61263 379383 ~ 617969 (+)
CI01000112_00220804_00222613 NA coding upstream 456573 220664 ~ 222659 (+)
CI01000112_00704149_00718204 CCDC40 coding downstream 24679 704149 ~ 718231 (+)
CI01000112_00727125_00743789 NA coding downstream 47614 727084 ~ 743999 (+)
CI01000112_00779771_00783376 CBX4 coding downstream 99903 779373 ~ 783522 (+)
CI01000112_00789475_00790952 CBX8 coding downstream 109286 788756 ~ 791433 (+)
CI01000112_00796321_00806383 DGKE coding downstream 116719 796189 ~ 807227 (+)
G327892 NA non-coding upstream 242 678771 ~ 678990 (+)
G327708 NA non-coding upstream 205337 465684 ~ 473895 (+)
G327876 NA non-coding upstream 336260 342665 ~ 342972 (+)
G327868 NA non-coding upstream 359709 319269 ~ 319523 (+)
G327866 NA non-coding upstream 366124 312635 ~ 313108 (+)
G327894 NA non-coding downstream 14 679484 ~ 679725 (+)
G327899 NA non-coding downstream 3929 683399 ~ 683611 (+)
G327900 NA non-coding downstream 4412 683882 ~ 684162 (+)
G327905 NA non-coding downstream 9075 688545 ~ 688764 (+)
G327675 NA non-coding downstream 13730 693200 ~ 696619 (+)
G328456 NA other downstream 552552 1232022 ~ 1233118 (+)
G329125 NA other downstream 1938234 2617704 ~ 2618151 (+)
G329194 NA other downstream 2240784 2920254 ~ 2931889 (+)
CI01000112_05076817_05101845 NA other downstream 4405250 5076817 ~ 5101845 (+)

Expression


Co-expression Network