G328608



Basic Information


Item Value
gene id G328608
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000112
NCBI id null
chromosome length 5247617
location 1460925 ~ 1461211 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU373492
TATTGATGAAGTTGTAAGCTGGTCAGTTTTCAAAATCACAAACATGCAGGTATGCTAAAGCACTATTTTTAAGCAGAGTAATTTATTTGTTTTGAAGTGGATAAACATTTATAAATGCCTTACAGTCAGGTGATTCCAGTGGATTATATTAAATCCTTTCACTCATCAGCACAGGCTTGTGTTCTGTGTGGAGTGTGTGGGATCTAGTGATAAAGTAAACCTCTGAACCGGTTTTACCTTCCACTGAAGCTCACATCAGGTGCACAGAGTTAAACTCTCCATGTGTG

Function


NR:

description
PREDICTED: tripartite motif-containing protein 47-like isoform X2

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU373492 True 287 lncRNA 0.38 1 1460925 1461211

Neighbor


gene id symbol gene type direction distance location
CI01000112_01304699_01321467 NA coding upstream 139217 1304303 ~ 1321708 (+)
CI01000112_00975908_00994568 RHOT1B, RHOT1, RHOT1A coding upstream 464860 975908 ~ 996065 (+)
CI01000112_00967726_00973214 NA coding upstream 487446 967726 ~ 973479 (+)
CI01000112_00943876_00960636 NA coding upstream 500289 943876 ~ 960636 (+)
CI01000112_00931318_00942127 SUZ12B, SUZ12 coding upstream 518540 931147 ~ 942385 (+)
CI01000112_01473681_01484126 NA coding downstream 12146 1473357 ~ 1484634 (+)
CI01000112_01493953_01497856 NA coding downstream 32742 1493953 ~ 1498684 (+)
CI01000112_01534218_01550547 MGAT5B coding downstream 73007 1534218 ~ 1550876 (+)
CI01000112_01711753_01717045 NA coding downstream 250021 1711232 ~ 1717114 (+)
CI01000112_01753138_01753764 NA coding downstream 291745 1752956 ~ 1754407 (+)
G328601 NA non-coding upstream 17511 1443081 ~ 1443414 (+)
G328600 NA non-coding upstream 27053 1433393 ~ 1433872 (+)
G328599 NA non-coding upstream 27885 1432523 ~ 1433040 (+)
G328474 NA non-coding upstream 114887 1345360 ~ 1346038 (+)
G328520 NA non-coding upstream 121060 1339535 ~ 1339865 (+)
G328609 NA non-coding downstream 191 1461402 ~ 1461609 (+)
G328611 NA non-coding downstream 4821 1466032 ~ 1466309 (+)
G328612 NA non-coding downstream 5486 1466697 ~ 1466920 (+)
G328588 NA non-coding downstream 93400 1554611 ~ 1555332 (+)
G328794 NA non-coding downstream 216934 1678145 ~ 1678925 (+)
G328456 NA other upstream 227807 1232022 ~ 1233118 (+)
G329125 NA other downstream 1156493 2617704 ~ 2618151 (+)
G329194 NA other downstream 1459043 2920254 ~ 2931889 (+)
CI01000112_05076817_05101845 NA other downstream 3623509 5076817 ~ 5101845 (+)

Expression



Co-expression Network