G328879


Basic Information

Item Value
gene id G328879
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000112
NCBI id null
chromosome length 5247617
location 1756188 ~ 1756537 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU373810
CAAATGTTGAAATGGTTTAATTTTAGTATGTTCCTCATACACAGATAAACTTGTAATAAAATGCACAAATCATATGACCTACTTTCATGGTGATTTTTTTTTCTTCGTTTTGAAAATCATGCATTTTGTTTGTATTAAAACAAGCAGATCATCTCTTTTTGCATTCAACAGAAGAAATTCATGTTTGGAACGACTTTTCTATGTAAGGTTTCCCAAAACGTCTATGCACTAAAACGGTTAGTTGCCCACTTATACACACAAACTGTGAGTATTTCCCCTTTCATACAAACAGTACATACAAGGTGTATTGTTTCCTGAGGCCGAAAGCGGGAAGTGACCTCTAAATGCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU373810 True 350 lncRNA 0.34 1 1756188 1756537

Neighbor

gene id symbol gene type direction distance location
CI01000112_01753138_01753764 NA coding upstream 1781 1752956 ~ 1754407 (+)
CI01000112_01711753_01717045 NA coding upstream 39074 1711232 ~ 1717114 (+)
CI01000112_01534218_01550547 MGAT5B coding upstream 205312 1534218 ~ 1550876 (+)
CI01000112_01493953_01497856 NA coding upstream 257504 1493953 ~ 1498684 (+)
CI01000112_01473681_01484126 NA coding upstream 271554 1473357 ~ 1484634 (+)
CI01000112_01831462_01857713 NA coding downstream 74925 1831462 ~ 1858703 (+)
CI01000112_01865388_01878028 LUC7L3 coding downstream 108564 1865101 ~ 1878188 (+)
CI01000112_01883455_01914770 NA coding downstream 126707 1883244 ~ 1914775 (+)
CI01000112_02017278_02032299 U2AF2 coding downstream 260741 2017278 ~ 2032413 (+)
CI01000112_02060950_02068272 UNM_SA1261 coding downstream 304184 2060721 ~ 2068604 (+)
G328878 NA non-coding upstream 905 1754952 ~ 1755283 (+)
G328876 NA non-coding upstream 3562 1752400 ~ 1752626 (+)
G328794 NA non-coding upstream 77263 1678145 ~ 1678925 (+)
G328588 NA non-coding upstream 200856 1554611 ~ 1555332 (+)
G328612 NA non-coding upstream 289268 1466697 ~ 1466920 (+)
G328830 NA non-coding downstream 19572 1776109 ~ 1802333 (+)
G328826 NA non-coding downstream 39559 1796096 ~ 1809959 (+)
G328823 NA non-coding downstream 41978 1798515 ~ 1800658 (+)
G328847 NA non-coding downstream 174108 1930645 ~ 1932170 (+)
G328840 NA non-coding downstream 217203 1973740 ~ 1974774 (+)
G328456 NA other upstream 523070 1232022 ~ 1233118 (+)
G329125 NA other downstream 861167 2617704 ~ 2618151 (+)
G329194 NA other downstream 1163717 2920254 ~ 2931889 (+)
CI01000112_05076817_05101845 NA other downstream 3328183 5076817 ~ 5101845 (+)

Expression


Co-expression Network