G329839


Basic Information

Item Value
gene id G329839
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000112
NCBI id null
chromosome length 5247617
location 2369527 ~ 2378160 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU374931
CATGAGGTCTAAATGGGATTTACTACATGCTAATCTATTAAAGATGGGACAATACCCACTTTATTTGGACCAACTTGCTCTTCAGAATCACAGCCTATCCAATCAGAATGGGGTTACATGCCAACAATAATGCGATGACACCTCTCTAGAGAAGAAACAGACCCTCGCTCGCTTCAAAGAGTCCAGGAGTGCTTTCAAACATCAACTGGTAATAAAACAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU374931 True 220 lncRNA 0.41 2 2369527 2378160

Neighbor

gene id symbol gene type direction distance location
CI01000112_02324515_02338662 NOTUM1A, NOTUM coding downstream 30438 2324389 ~ 2339089 (-)
CI01000112_02317589_02318500 MYADML2 coding downstream 50642 2317504 ~ 2318885 (-)
CI01000112_02308544_02314940 PYCR2, PYCR1, PYCR1A coding downstream 54587 2308118 ~ 2314940 (-)
CI01000112_02283088_02284461 NA coding downstream 84987 2282912 ~ 2284540 (-)
CI01000112_02269456_02270414 NA coding downstream 99113 2268832 ~ 2270414 (-)
CI01000112_02412957_02416960 STRA13 coding upstream 34777 2412937 ~ 2417013 (-)
CI01000112_02425312_02445848 NA coding upstream 46902 2425062 ~ 2445848 (-)
CI01000112_02630198_02636420 NA coding upstream 251677 2629837 ~ 2636428 (-)
CI01000112_02732722_02733132 NA coding upstream 354420 2732580 ~ 2734440 (-)
CI01000112_02830996_02831270 NA coding upstream 451684 2829844 ~ 2831270 (-)
G329799 NA non-coding downstream 64922 2303939 ~ 2304605 (-)
G329805 NA non-coding downstream 86670 2282645 ~ 2282857 (-)
CI01000112_02185619_02204929 C14H16ORF52 non-coding downstream 156900 2185093 ~ 2212627 (-)
G329767 NA non-coding downstream 187962 2180814 ~ 2181565 (-)
G329769 NA non-coding downstream 212623 2156091 ~ 2156904 (-)
G329868 NA non-coding upstream 27241 2405401 ~ 2405724 (-)
G329723 NA non-coding upstream 76383 2454543 ~ 2462342 (-)
G329720 NA non-coding upstream 93519 2471679 ~ 2575549 (-)
G329730 NA non-coding upstream 104244 2482404 ~ 2538479 (-)
G329672 NA other downstream 350074 2016704 ~ 2019453 (-)
G329569 NA other downstream 371668 1991666 ~ 1997859 (-)
G329559 NA other downstream 559788 1791084 ~ 1809739 (-)
G329587 NA other downstream 736205 1629776 ~ 1633322 (-)
G328642 NA other downstream 1082569 1286655 ~ 1286958 (-)
CI01000112_03068505_03072256 NA other upstream 689160 3067320 ~ 3072879 (-)
CI01000112_03506254_03517454 NA other upstream 1126295 3504455 ~ 3518742 (-)
G330301 NA other upstream 1381639 3758244 ~ 3773774 (-)

Expression


Co-expression Network