G330311


Basic Information

Item Value
gene id G330311
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000112
NCBI id null
chromosome length 5247617
location 3786743 ~ 3787148 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU375471
GGACCTCAGACTGGGCCGAAGGTTTACCTTCCAACAAGACAATGACCCTAAGCACACAGCTAAAATAACGTAGGAGTGGCTTCACAACAACTCTGTGACTGTTCTTGAATGGCCCAGCCAGAGCCCTGACTTAAACCCAATTGAGCATCTCTGGAGAGACCTAAAAATGGCTGTCCACCAATGTTTACCATCCAACCTGACTGTTGCATCTTTCCCAAAAAGACTCATGGCTGTATTAGATCAAAAGGGTGCTTCTAGAAAATACTGAGCAAAGGGTCTGAATACTTAGGACCATGTGATATTTCAGTTTTTCTTTTTTAATAAATCTGCAAAAATGTCAACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU375471 True 343 lncRNA 0.42 2 3786743 3787148

Neighbor

gene id symbol gene type direction distance location
CI01000112_03569282_03569449 NA coding downstream 216960 3569117 ~ 3569783 (-)
CI01000112_03506254_03517454 NA coding downstream 269112 3504455 ~ 3518742 (-)
CI01000112_03393172_03448154 PRKCA coding downstream 338589 3391852 ~ 3448154 (-)
CI01000112_03367247_03384263 CACNG5B, CACNG5, CACNG5A coding downstream 400859 3366873 ~ 3385884 (-)
CI01000112_03291919_03299963 RAC3B, RAC3, RAC3A, RAC1, RAC1A, RAC1B, RAC3.S, RAC1.L coding downstream 486780 3291241 ~ 3299963 (-)
CI01000112_04031927_04033721 NA coding upstream 244692 4031840 ~ 4033830 (-)
CI01000112_04095809_04175244 NA coding upstream 308132 4095280 ~ 4175284 (-)
CI01000112_04190915_04191720 NA coding upstream 403576 4190724 ~ 4191720 (-)
CI01000112_04249185_04251352 GPRC5BA, GPRC5B coding upstream 462006 4249154 ~ 4251394 (-)
CI01000112_04289359_04311224 PROZA coding upstream 501769 4288917 ~ 4311224 (-)
G330301 NA non-coding downstream 12969 3758244 ~ 3773774 (-)
G330279 NA non-coding downstream 74712 3711539 ~ 3712031 (-)
G330002 NA non-coding downstream 230625 3542282 ~ 3556118 (-)
G330020 NA non-coding downstream 283435 3487307 ~ 3503308 (-)
G330012 NA non-coding downstream 300967 3469925 ~ 3485776 (-)
G330329 NA non-coding upstream 50851 3837999 ~ 3842458 (-)
G329976 NA non-coding upstream 95087 3882235 ~ 3883324 (-)
G330361 NA non-coding upstream 187059 3974207 ~ 3974827 (-)
G330362 NA non-coding upstream 187684 3974832 ~ 3975353 (-)
G330363 NA non-coding upstream 188520 3975668 ~ 3976088 (-)
CI01000112_03068505_03072256 NA other downstream 714013 3067320 ~ 3072879 (-)
G329672 NA other downstream 1767290 2016704 ~ 2019453 (-)
G329569 NA other downstream 1788884 1991666 ~ 1997859 (-)

Expression


Co-expression Network