G330384



Basic Information


Item Value
gene id G330384
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000112
NCBI id null
chromosome length 5247617
location 4104238 ~ 4104501 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU375548
CACACACACACACACACATTTCAAAAAGTGAAAAACATTCACATCTCCAAAAGATTGTAACATGCTGAATAATAAAAAACGGTTACTAAATTTAATGAGACTGATTATTATAGTTAAATAAAAATATAAAAACATGGAAAAAGTTTTCCTCCAGCAATGATATCTGAATGTGTTAACAATTGCTTTTAGTTTGAAATATAAATTTTAAAAATGTGTTCATATAAGTAAAAGAATATTTTTTTAACAATGTCAATGCAAAAAGGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU375548 True 264 lncRNA 0.25 1 4104238 4104501

Neighbor


gene id symbol gene type direction distance location
CI01000112_04031927_04033721 NA coding downstream 70408 4031840 ~ 4033830 (-)
CI01000112_03569282_03569449 NA coding downstream 534455 3569117 ~ 3569783 (-)
CI01000112_03506254_03517454 NA coding downstream 586607 3504455 ~ 3518742 (-)
CI01000112_03393172_03448154 PRKCA coding downstream 656084 3391852 ~ 3448154 (-)
CI01000112_03367247_03384263 CACNG5B, CACNG5, CACNG5A coding downstream 718354 3366873 ~ 3385884 (-)
CI01000112_04190915_04191720 NA coding upstream 86223 4190724 ~ 4191720 (-)
CI01000112_04249185_04251352 GPRC5BA, GPRC5B coding upstream 144653 4249154 ~ 4251394 (-)
CI01000112_04289359_04311224 PROZA coding upstream 184416 4288917 ~ 4311224 (-)
CI01000112_04369901_04370950 NA coding upstream 265009 4369510 ~ 4371003 (-)
CI01000112_04374111_04376875 NA coding upstream 269370 4373871 ~ 4376993 (-)
G330377 NA non-coding downstream 5409 4098576 ~ 4098829 (-)
G329970 NA non-coding downstream 65941 4035606 ~ 4038297 (-)
G329987 NA non-coding downstream 110649 3990981 ~ 3993589 (-)
G330363 NA non-coding downstream 128150 3975668 ~ 3976088 (-)
G330362 NA non-coding downstream 128885 3974832 ~ 3975353 (-)
G330857 NA non-coding upstream 43879 4148380 ~ 4148644 (-)
G330858 NA non-coding upstream 45495 4149996 ~ 4150261 (-)
G330889 NA non-coding upstream 81804 4186305 ~ 4186530 (-)
G330891 NA non-coding upstream 83333 4187834 ~ 4188205 (-)
G330899 NA non-coding upstream 94607 4199108 ~ 4199326 (-)
G330301 NA other downstream 335633 3758244 ~ 3773774 (-)
CI01000112_03068505_03072256 NA other downstream 1031508 3067320 ~ 3072879 (-)
G329672 NA other downstream 2084785 2016704 ~ 2019453 (-)
G329569 NA other downstream 2106379 1991666 ~ 1997859 (-)

Expression



Co-expression Network