CI01000113_00254945_00255661 (HBAA1)


Basic Information

Item Value
gene id CI01000113_00254945_00255661
gene name HBAA1
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 254858 ~ 255709 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000113_00254945_00255661.mRNA
ATCTTTTTTTCTGAAGACGATCTAACTTGAGAAAAAGAAGACGCAGCAATGAGTCTCTCTGATAAGGACAAGGCTGTTGTGAAGGCCATATGGGCTAAGATCAGCTCTAGGGCCGATGACATCGGCGCTGAAGCCCTCGGCAGGATGCTGACCGTCTACCCTCAGACCAAGACCTACTTCTCTCACTGGGCTGACCTGAGCCCCGGGTCTGGTCCTGTGAAGAAGCACGGCCACGTTATCATGGCTGCAGTCGGCGATGCCGTTTCAAAAATAGACGACCTTGCGGGAGGTCTGGCCGCCCTGAGCGAACTTCATGCTTTCAAGCTGCGTGTTGACCCGGCCAACTTCAAGATCCTCGCACACAATCTCATAGTGGTCATCGCCATGCTCTTCCCTGCCGACTTCACCCCAGAGGTTCATGTGTCAGTTGACAAGTTTTTCCAGAACTTGGCCCTGGCTCTTTCTGAGAAGTACCGCTAATCCTCCAGTGGGCATCCACAGGCAACACTGCAGCACGGCACCTCTAACCAACTCATGCATGATGTCTGAATAATATTTCTCAATAAA

Function

symbol description
hbaa1 Predicted to enable several functions, including heme binding activity; oxygen binding activity; and oxygen carrier activity. Predicted to contribute to haptoglobin binding activity and peroxidase activity. Acts upstream of or within response to hypoxia. Predicted to be part of haptoglobin-hemoglobin complex and hemoglobin complex. Is expressed in eye; hematopoietic system; presumptive blood; and vasculature. Human ortholog(s) of this gene implicated in Heinz body anemia; alpha thalassemia; familial erythrocytosis 7; and hemoglobin H disease. Orthologous to several human genes including HBZ (hemoglobin subunit zeta).

GO:

id name namespace
GO:0005344 oxygen carrier activity molecular_function

KEGG:

id description
K13826 HBZ; hemoglobin subunit zeta

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000113_00254945_00255661.mRNA True 567 mRNA 0.52 3 254858 255709

Neighbor

gene id symbol gene type direction distance location
CI01000113_00122344_00130639 ELAVL3 coding downstream 124151 121854 ~ 130707 (-)
CI01000113_00077172_00080517 NA coding downstream 174341 75223 ~ 80517 (-)
CI01000113_00268929_00271262 NA coding upstream 13139 268848 ~ 271294 (-)
CI01000113_00283931_00284691 NA coding upstream 28153 283862 ~ 284723 (-)
CI01000113_00301490_00302258 NA coding upstream 45699 301408 ~ 302281 (-)
CI01000113_00308045_00308457 HBBE2, HBBE1.1 coding upstream 52195 307904 ~ 308514 (-)
CI01000113_00324040_00324756 HBAA1 coding upstream 68242 323951 ~ 324804 (-)
G332283 NA non-coding downstream 15805 237050 ~ 239053 (-)
G332264 NA non-coding downstream 44000 209581 ~ 210858 (-)
G332231 NA non-coding downstream 171015 83542 ~ 83843 (-)
G332230 NA non-coding downstream 171397 82937 ~ 83461 (-)
G332229 NA non-coding downstream 172742 81900 ~ 82116 (-)
G332152 NA non-coding upstream 1115 256824 ~ 327004 (-)
G332158 NA non-coding upstream 21654 277363 ~ 334616 (-)
G332312 NA non-coding upstream 118308 374017 ~ 374294 (-)
G332313 NA non-coding upstream 118777 374486 ~ 374692 (-)
G332344 NA non-coding upstream 192241 447950 ~ 448335 (-)
G332210 NA other downstream 205373 47990 ~ 49485 (-)
G332160 NA other upstream 134518 390227 ~ 446837 (-)
G332649 NA other upstream 1891505 2147214 ~ 2148558 (-)
G332837 NA other upstream 1995136 2250845 ~ 2251213 (-)
CI01000113_02356565_02370009 NA other upstream 2111907 2356565 ~ 2370009 (-)

Expression


Co-expression Network