G332415


Basic Information

Item Value
gene id G332415
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 754741 ~ 754962 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU377917
GTTTAAAGAGTCATCAGCTGCGCTCGAGCCTCGAGAGATCTTATGTTATTGAAGTTTGACATCTAATACTAATAGTATTAATCTATTAACAATTAATAATTAACATAATAGAAACTAATAGTATTAGATGTCTATGCACCTGTGCTCTCAGAAAGAAGTATCTTTTAGAAAATGACTTATCGTGAGAGTTTTAGTGGCATAACATCGGTTAATGGAAACGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU377917 True 222 lncRNA 0.33 1 754741 754962

Neighbor

gene id symbol gene type direction distance location
CI01000113_00616541_00627359 NA coding downstream 127382 616361 ~ 627359 (-)
CI01000113_00611039_00611881 P2RY11 coding downstream 142802 610860 ~ 611939 (-)
CI01000113_00593453_00601556 EIF3G coding downstream 153185 593382 ~ 601556 (-)
CI01000113_00529415_00542504 NA coding downstream 211721 529230 ~ 543020 (-)
CI01000113_00511782_00515713 NA coding downstream 239028 511423 ~ 515713 (-)
CI01000113_00770409_00789987 OLFM2, OLFM2A coding upstream 15171 770133 ~ 790683 (-)
CI01000113_00907179_00957938 COL5A3B, COL5A3, COL5A3A coding upstream 151979 906941 ~ 958094 (-)
CI01000113_01096667_01106622 RDH8 coding upstream 341360 1096322 ~ 1106870 (-)
CI01000113_01137145_01178626 CAMSAP3 coding upstream 382035 1136997 ~ 1178626 (-)
CI01000113_01180049_01192316 XAB2, SYF1 coding upstream 424874 1179836 ~ 1192316 (-)
G332414 NA non-coding downstream 2842 751655 ~ 751899 (-)
G332393 NA non-coding downstream 32885 721657 ~ 721856 (-)
G332389 NA non-coding downstream 48480 705979 ~ 706261 (-)
G332384 NA non-coding downstream 64753 689750 ~ 689988 (-)
G332165 NA non-coding downstream 105815 645590 ~ 648926 (-)
G332405 NA non-coding upstream 83619 838581 ~ 846812 (-)
G332427 NA non-coding upstream 108372 863334 ~ 869739 (-)
G332458 NA non-coding upstream 222338 977300 ~ 977523 (-)
G332524 NA non-coding upstream 362849 1117811 ~ 1118547 (-)
G332574 NA non-coding upstream 484709 1239671 ~ 1239956 (-)
G332160 NA other downstream 307904 390227 ~ 446837 (-)
G332210 NA other downstream 705256 47990 ~ 49485 (-)
G332649 NA other upstream 1392252 2147214 ~ 2148558 (-)
G332837 NA other upstream 1495883 2250845 ~ 2251213 (-)
CI01000113_02356565_02370009 NA other upstream 1612654 2356565 ~ 2370009 (-)

Expression


Co-expression Network