G331647


Basic Information

Item Value
gene id G331647
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 1202089 ~ 1202303 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU376993
TACATTTCCATCTTTCGGCTCTCTGATGGTGAATGCCTCCATCCCTGGCAATGAACTAAGCGTCACTCGTTGGTCATCTAATCGTTGGCTCTGACTCTTGAGCAGGAACTGGAAAAACTCATCGGCTTCTGCTGCAGTGCCGTCCAAAGAGACACGAACATGTAAATGTTACTTTTAAGGCAAGACACTACAGACAAAACCTGTGTTTTTTCACG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU376993 True 215 lncRNA 0.46 1 1202089 1202303

Neighbor

gene id symbol gene type direction distance location
CI01000113_01127641_01134250 NA coding upstream 67608 1127641 ~ 1134481 (+)
CI01000113_01120464_01124821 NA coding upstream 77058 1120398 ~ 1125031 (+)
CI01000113_01110162_01112498 NA coding upstream 89587 1110162 ~ 1112502 (+)
CI01000113_01072283_01091398 NOTCH3 coding upstream 110359 1071905 ~ 1091730 (+)
CI01000113_00997825_01005290 RDH8A, RDH8 coding upstream 196690 996863 ~ 1005399 (+)
CI01000113_01292096_01298082 NA coding downstream 89650 1291953 ~ 1299919 (+)
CI01000113_01321501_01326215 NA coding downstream 119053 1321356 ~ 1326350 (+)
CI01000113_01329811_01334714 LPAR2A coding downstream 126580 1328883 ~ 1334735 (+)
CI01000113_01376249_01385209 NA coding downstream 171764 1374067 ~ 1385402 (+)
CI01000113_01424978_01425704 NA coding downstream 222675 1424968 ~ 1425835 (+)
G331646 NA non-coding upstream 2460 1199396 ~ 1199629 (+)
G331645 NA non-coding upstream 3491 1198396 ~ 1198598 (+)
G331644 NA non-coding upstream 5065 1196784 ~ 1197024 (+)
G331495 NA non-coding upstream 83550 1117811 ~ 1118539 (+)
G331496 NA non-coding upstream 132118 1063948 ~ 1069971 (+)
G331651 NA non-coding downstream 3284 1205587 ~ 1205877 (+)
G331652 NA non-coding downstream 3676 1205979 ~ 1206262 (+)
G331619 NA non-coding downstream 26800 1229103 ~ 1235130 (+)
G331590 NA non-coding downstream 47377 1249680 ~ 1251812 (+)
G331583 NA non-coding downstream 54885 1257188 ~ 1257858 (+)
G331487 NA other upstream 279956 917735 ~ 922133 (+)
G331470 NA other upstream 285552 913392 ~ 916537 (+)
G331260 NA other upstream 867468 334158 ~ 334621 (+)
G331615 NA other downstream 43988 1246291 ~ 1246573 (+)
G331767 NA other downstream 460482 1662785 ~ 1663255 (+)
G331759 NA other downstream 465699 1668002 ~ 1828903 (+)
CI01000113_02342987_02345449 SYCE2 other downstream 1141118 2342987 ~ 2346006 (+)

Expression


Co-expression Network