G332574



Basic Information


Item Value
gene id G332574
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 1239671 ~ 1239956 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU378095
ATTGTTTGTTTATAAGCATACTGGTGATGAAAATGACCATTTCACCTTTGTGTATGATTTCTCACTATGGAAAGAAAAACACGTTATTGTGCAGCAGTCTAAATTATTTTATGTTTTAAATGGCAAACTAAAGCTACACTCAAACAACCAGAAAACAGACCTATCCTGTGAAGTGTGACACATTCTTTAAAAGAGACGCAGAGAAGCTGAATGTCCACCAGTGTCTTCTTCTGAAGAGTTCATGTTTTCCACCAATATCTGAAATCTCAGGAAGTGCTTCTTCATC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU378095 True 286 lncRNA 0.36 1 1239671 1239956

Neighbor


gene id symbol gene type direction distance location
CI01000113_01208541_01221483 STXBP2 coding downstream 17588 1207889 ~ 1222083 (-)
CI01000113_01180049_01192316 XAB2, SYF1 coding downstream 47355 1179836 ~ 1192316 (-)
CI01000113_01137145_01178626 CAMSAP3 coding downstream 61045 1136997 ~ 1178626 (-)
CI01000113_01096667_01106622 RDH8 coding downstream 132801 1096322 ~ 1106870 (-)
CI01000113_00907179_00957938 COL5A3B, COL5A3, COL5A3A coding downstream 281577 906941 ~ 958094 (-)
CI01000113_01252186_01255334 NA coding upstream 12230 1252186 ~ 1255410 (-)
CI01000113_01259501_01275141 BRD4, BRD2, BRD3 coding upstream 19182 1259138 ~ 1275141 (-)
CI01000113_01351820_01359750 PBX3, PBX1 coding upstream 111456 1351412 ~ 1361658 (-)
CI01000113_01396970_01402406 NA coding upstream 156475 1396431 ~ 1402406 (-)
CI01000113_01404787_01423732 ATP13A1 coding upstream 164710 1404666 ~ 1423732 (-)
G332524 NA non-coding downstream 121124 1117811 ~ 1118547 (-)
G332458 NA non-coding downstream 262148 977300 ~ 977523 (-)
G332427 NA non-coding downstream 369932 863334 ~ 869739 (-)
G332405 NA non-coding downstream 392859 838581 ~ 846812 (-)
G332415 NA non-coding downstream 484709 754741 ~ 754962 (-)
G332523 NA non-coding upstream 6337 1246293 ~ 1246573 (-)
G332587 NA non-coding upstream 167864 1407820 ~ 1408432 (-)
G332596 NA non-coding upstream 303278 1543234 ~ 1543454 (-)
G332597 NA non-coding upstream 304234 1544190 ~ 1544419 (-)
G332160 NA other downstream 792834 390227 ~ 446837 (-)
G332210 NA other downstream 1190186 47990 ~ 49485 (-)
G332649 NA other upstream 907258 2147214 ~ 2148558 (-)
G332837 NA other upstream 1010889 2250845 ~ 2251213 (-)
CI01000113_02356565_02370009 NA other upstream 1127660 2356565 ~ 2370009 (-)

Expression



Co-expression Network