G332666


Basic Information

Item Value
gene id G332666
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 1709639 ~ 1738696 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU378193
ACCTCTGACTGAAATCCAGCTCTTGGGCGACTCTCCTATCTCTGGGTGTTTGCAGTAGTAGAAACCCTCATGTGACTTTGAGACAGTAGGGATGATCATCTCTGTAGTTTGATTCTGGATGAGTGATCCATCTTTATAGAAATCAGCTCTGAGGTTTGATAGGGTTTTATTTTGATATAAACAGTGTAGAGTCAGATTATCTCTTTCAGTCACAGGATGAACAGGACTCTCCAGAACCACACCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU378193 True 245 lncRNA 0.42 2 1709639 1738696

Neighbor

gene id symbol gene type direction distance location
CI01000113_01652528_01653349 NA coding downstream 56193 1652386 ~ 1653446 (-)
CI01000113_01589305_01600983 NA coding downstream 108627 1589154 ~ 1601012 (-)
CI01000113_01569971_01571224 PTGER1C coding downstream 137837 1569308 ~ 1571802 (-)
CI01000113_01554726_01565897 SLC27A1A, SLC27A1 coding downstream 143742 1554144 ~ 1565897 (-)
CI01000113_01502427_01506373 NA coding downstream 203266 1502161 ~ 1506373 (-)
CI01000113_01846674_01851715 BTBD17B coding upstream 107672 1846368 ~ 1851790 (-)
CI01000113_01854931_01857730 NA coding upstream 116070 1854766 ~ 1858875 (-)
CI01000113_01871256_01883265 PDGFAB coding upstream 131694 1870390 ~ 1884400 (-)
CI01000113_01908893_01913809 NA coding upstream 170043 1908739 ~ 1914228 (-)
CI01000113_01917876_01982420 PRKAR1B coding upstream 178590 1917286 ~ 1982420 (-)
G332624 NA non-coding downstream 46383 1663025 ~ 1663256 (-)
G332623 NA non-coding downstream 46655 1662756 ~ 1662984 (-)
G332622 NA non-coding downstream 50701 1658725 ~ 1658938 (-)
G332621 NA non-coding downstream 64289 1645000 ~ 1645350 (-)
G332611 NA non-coding downstream 123364 1586026 ~ 1586275 (-)
G332731 NA non-coding upstream 31318 1770014 ~ 1824432 (-)
G332670 NA non-coding upstream 92725 1831421 ~ 1831849 (-)
G332751 NA non-coding upstream 93704 1832400 ~ 1833305 (-)
G332657 NA non-coding upstream 278646 2017342 ~ 2017775 (-)
G332160 NA other downstream 1262802 390227 ~ 446837 (-)
G332210 NA other downstream 1660154 47990 ~ 49485 (-)
G332649 NA other upstream 408518 2147214 ~ 2148558 (-)
G332837 NA other upstream 512149 2250845 ~ 2251213 (-)
CI01000113_02356565_02370009 NA other upstream 628920 2356565 ~ 2370009 (-)

Expression


Co-expression Network