G331840


Basic Information

Item Value
gene id G331840
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 1855831 ~ 1856934 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU377246
TTTTTAGTTGATTTCTTTTTCTCTGTCTCTTCTTTCTTTAGCTCGACCTCTGGCTGTCGCTCTACCTGGTTGTTTGTGAGGAAGAGGACATGCTCAGTCTCTTGGGTCATGCGGTGGATGTAAGCTTTCTCTGACTCCTGTCGCCCTCTGCGGAAGTGTGGGATAGGAATATCTCCTGAGACCATCTTTGGTTTAGAGGCTTTTTTTCCTTTTCTGGGAGCCTTGTTTCATCATCTCTTTACTCTTCATGATTTCACGCAAACGTTGAGGAATCTGCTGGAGGTGATCGTCTGATGCAGGATCAGCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU377246 True 307 lncRNA 0.46 2 1855831 1856934

Neighbor

gene id symbol gene type direction distance location
CI01000113_01834891_01839297 KCNJ2, KCNJ2A coding upstream 15705 1834891 ~ 1840126 (+)
CI01000113_01826332_01833431 NA coding upstream 22302 1825854 ~ 1833529 (+)
CI01000113_01761054_01815819 NA coding upstream 39834 1760927 ~ 1815997 (+)
CI01000113_01716646_01752755 NA coding upstream 102480 1715749 ~ 1753351 (+)
CI01000113_01698764_01709585 NA coding upstream 146123 1698624 ~ 1709708 (+)
CI01000113_01983091_01989335 NA coding downstream 126157 1983091 ~ 1989335 (+)
CI01000113_01994682_02001599 DNAAF5 coding downstream 137748 1994682 ~ 2002028 (+)
CI01000113_02042831_02055567 NA coding downstream 183064 2039998 ~ 2056124 (+)
CI01000113_02059842_02092732 SLC9A3R2 coding downstream 202908 2059842 ~ 2093663 (+)
CI01000113_02111396_02122911 NA coding downstream 253701 2110635 ~ 2123037 (+)
G331790 NA non-coding upstream 74141 1733674 ~ 1781690 (+)
G331793 NA non-coding upstream 98853 1755457 ~ 1756978 (+)
G331756 NA non-coding upstream 217398 1638118 ~ 1638433 (+)
G331755 NA non-coding upstream 219171 1636151 ~ 1636660 (+)
G331820 NA non-coding downstream 49485 1906419 ~ 1909070 (+)
G331824 NA non-coding downstream 141510 1998444 ~ 2057885 (+)
G331833 NA non-coding downstream 173904 2030838 ~ 2034228 (+)
G331907 NA non-coding downstream 214601 2071535 ~ 2072337 (+)
G331914 NA non-coding downstream 249345 2106279 ~ 2106617 (+)
G331759 NA other upstream 26928 1668002 ~ 1828903 (+)
G331767 NA other upstream 192576 1662785 ~ 1663255 (+)
CI01000113_01424978_01425704 NA other upstream 430125 1424968 ~ 1425835 (+)
G331615 NA other upstream 609258 1246291 ~ 1246573 (+)
G331487 NA other upstream 933698 917735 ~ 922133 (+)
CI01000113_02342987_02345449 SYCE2 other downstream 486487 2342987 ~ 2346006 (+)
CI01000113_02548934_02576888 TBL3 other downstream 711833 2548934 ~ 2577790 (+)

Expression


Co-expression Network