G332871


Basic Information

Item Value
gene id G332871
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 2298469 ~ 2298893 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU378429
GCAAAATCACACTTCTTTCTTTCTTTCTTTCTTTCTTTTATAATAATAAAAAAAAACTTGGATTTTGCTCTAGTGAGACTTGTCTCCCCAAATATTACCATTAAGTGTTGCAAAATACCTGAGAATTAATATGAATCGATATTGGGAAATAGAAATGTGTAATTATTAGACTTATACGATCATTTTACTTTGCTACTTAAAATAGATGTTGCTTCATTGCGTACGAAAGACTTTCATTTGGTATAATTTGTCTGTTATATCTAACAGGCACTTGTTGACGCCCAAACTACCCCCGTAACTCTAAAATCTAGAGCAGACCAATAAAAAATAAAAATAATAACATAATATATCTTACATATTCAATATACTCTCAAGTTAAAGTTAAATTGTATAAAAATGAACACGGCAGTGCAAGTAAACAAGGG

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU378429 True 425 lncRNA 0.30 1 2298469 2298893

Neighbor

gene id symbol gene type direction distance location
CI01000113_02193825_02200601 TUBB4A, TUFM coding downstream 97194 2193355 ~ 2201275 (-)
CI01000113_02170894_02179511 AMDHD2 coding downstream 117050 2170761 ~ 2181419 (-)
CI01000113_02159290_02165087 SLC25A19 coding downstream 133382 2158710 ~ 2165087 (-)
CI01000113_02136165_02143106 NA coding downstream 155363 2135324 ~ 2143106 (-)
CI01000113_02127709_02131244 DHYS, DHPS coding downstream 167225 2127209 ~ 2131244 (-)
CI01000113_02334123_02335356 NA coding upstream 34618 2333511 ~ 2335356 (-)
CI01000113_02348726_02354574 GCDHB, GCDH.L, GCDHA, GCDH coding upstream 49713 2348606 ~ 2354574 (-)
CI01000113_02356565_02370009 NA coding upstream 57672 2356565 ~ 2370009 (-)
CI01000113_02479865_02481505 NA coding upstream 179924 2478817 ~ 2483526 (-)
CI01000113_02491883_02493061 NFIL3-6 coding upstream 191760 2490653 ~ 2493575 (-)
G332866 NA non-coding downstream 8447 2289648 ~ 2290022 (-)
G332656 NA non-coding downstream 140108 2156517 ~ 2158361 (-)
G332821 NA non-coding downstream 151969 2146202 ~ 2146500 (-)
G332820 NA non-coding downstream 152728 2144904 ~ 2145741 (-)
G332638 NA non-coding downstream 179323 2118370 ~ 2119146 (-)
G332872 NA non-coding upstream 5373 2304266 ~ 2330958 (-)
G332894 NA non-coding upstream 114816 2413709 ~ 2419211 (-)
G332898 NA non-coding upstream 129965 2428858 ~ 2455150 (-)
G332917 NA non-coding upstream 160308 2459201 ~ 2459588 (-)
G332919 NA non-coding upstream 164426 2463319 ~ 2463563 (-)
G332837 NA other downstream 47256 2250845 ~ 2251213 (-)
G332649 NA other downstream 149911 2147214 ~ 2148558 (-)
G332160 NA other downstream 1851632 390227 ~ 446837 (-)
G332210 NA other downstream 2248984 47990 ~ 49485 (-)

Expression


Co-expression Network