G331978



Basic Information


Item Value
gene id G331978
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 2370374 ~ 2370577 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU377409
CTATACCATGTCAATATCCATTTAAATCTCATGACCACATCATGCTTATGCAACACGCTAAACATGACAATTGCTGACAGGCAAAATTATTATGTATTATATTAAGTATTCATAATAAATAATAATTATTATTAGTAAAAATAATTATAATTATAATATAATAAGCATGTGTTTTACTGACAGTTACAATTGGTCTTTGTTTTT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU377409 True 204 lncRNA 0.24 1 2370374 2370577

Neighbor


gene id symbol gene type direction distance location
CI01000113_02342987_02345449 SYCE2 coding upstream 24368 2342987 ~ 2346006 (+)
CI01000113_02321704_02328603 FARSA, FARSA.S, SYFA coding upstream 41511 2321704 ~ 2328863 (+)
CI01000113_02300492_02320320 ILF3B, ILF3 coding upstream 49804 2297820 ~ 2320570 (+)
CI01000113_02293534_02295639 NA coding upstream 74686 2292344 ~ 2295688 (+)
CI01000113_02227694_02239947 WIZ coding upstream 130282 2227694 ~ 2240092 (+)
CI01000113_02387553_02403367 SLC44A2 coding downstream 16976 2387553 ~ 2403367 (+)
CI01000113_02418950_02434326 NA coding downstream 48373 2418950 ~ 2434456 (+)
CI01000113_02548934_02576888 TBL3 coding downstream 178357 2548934 ~ 2577790 (+)
CI01000113_02623348_02657507 TOM1L2 coding downstream 252560 2623137 ~ 2657507 (+)
CI01000113_02685260_02707606 SREBF1 coding downstream 314683 2685260 ~ 2708849 (+)
G331977 NA non-coding upstream 363 2369772 ~ 2370011 (+)
G331976 NA non-coding upstream 1192 2368884 ~ 2369182 (+)
G331948 NA non-coding upstream 5077 2363574 ~ 2365297 (+)
G331971 NA non-coding upstream 10408 2358189 ~ 2359966 (+)
G331939 NA non-coding upstream 120020 2249934 ~ 2250354 (+)
G331979 NA non-coding downstream 1225 2371802 ~ 2372003 (+)
G331981 NA non-coding downstream 8663 2379240 ~ 2456507 (+)
G331982 NA non-coding downstream 21740 2392317 ~ 2404988 (+)
G332017 NA non-coding downstream 88612 2459189 ~ 2459471 (+)
G332037 NA non-coding downstream 147264 2517841 ~ 2518152 (+)
G331759 NA other upstream 541471 1668002 ~ 1828903 (+)
G331767 NA other upstream 707119 1662785 ~ 1663255 (+)
CI01000113_01424978_01425704 NA other upstream 944668 1424968 ~ 1425835 (+)
G331615 NA other upstream 1123801 1246291 ~ 1246573 (+)

Expression



Co-expression Network