G332975



Basic Information


Item Value
gene id G332975
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 2592283 ~ 2592482 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU378554
GGGGAGTGGAGGGTGGGAGGAGCCAAGGGGGAGCCTGGAGCAGGAGGAGCCAGATGTTGGTCCAGAGACCAACCATGACGAGGCCCCAGGGTGGAGTCGAAGGCGGGAGGAGCCATGGTGGAGACTTGAGAGGCGCCATCCTGGGGACGGCCGATAGAAACGTCACTGGAGATGGAGACCCAGGTGGAGCTGGCATGCCG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU378554 True 200 lncRNA 0.65 1 2592283 2592482

Neighbor


gene id symbol gene type direction distance location
CI01000113_02585185_02588728 NOXO1 coding downstream 3486 2584692 ~ 2588797 (-)
CI01000113_02542996_02548587 SCO1 coding downstream 43696 2542996 ~ 2548587 (-)
CI01000113_02491883_02493061 NFIL3-6 coding downstream 98708 2490653 ~ 2493575 (-)
CI01000113_02479865_02481505 NA coding downstream 108757 2478817 ~ 2483526 (-)
CI01000113_02356565_02370009 NA coding downstream 222274 2356565 ~ 2370009 (-)
CI01000113_02604593_02611740 GID4, CQ039 coding upstream 12051 2604533 ~ 2611990 (-)
CI01000113_02614236_02620012 NA coding upstream 21744 2614226 ~ 2620012 (-)
CI01000113_02719034_02729100 RAI1 coding upstream 126260 2718742 ~ 2729100 (-)
CI01000113_02791507_02858943 FAM20C coding upstream 198076 2790558 ~ 2859353 (-)
G332974 NA non-coding downstream 1657 2590162 ~ 2590626 (-)
G332962 NA non-coding downstream 15281 2568653 ~ 2577002 (-)
G332961 NA non-coding downstream 24178 2567872 ~ 2568105 (-)
G332960 NA non-coding downstream 24437 2567440 ~ 2567846 (-)
G332863 NA non-coding downstream 28109 2551528 ~ 2564174 (-)
G332977 NA non-coding upstream 6354 2598836 ~ 2599120 (-)
G332978 NA non-coding upstream 7076 2599558 ~ 2599769 (-)
G332931 NA non-coding upstream 103743 2696225 ~ 2696794 (-)
G332940 NA non-coding upstream 110913 2703395 ~ 2704698 (-)
G332945 NA non-coding upstream 155274 2747756 ~ 2755692 (-)
G332837 NA other downstream 341070 2250845 ~ 2251213 (-)
G332649 NA other downstream 443725 2147214 ~ 2148558 (-)
G332160 NA other downstream 2145446 390227 ~ 446837 (-)
G332210 NA other downstream 2542798 47990 ~ 49485 (-)

Expression



Co-expression Network