G332098


Basic Information

Item Value
gene id G332098
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 2785420 ~ 2785663 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU377540
ATTTCATTTCTGACGGAGGTGGCGTTTAGCTGCTTTTGCATCGTAAGTCTTCAAATATACTTTATGTATTTAATCTCACTTCATTAACCAGTGTCTTTGCTGCTGACCTTAGGTGATCCAGTGTTGAACTTTCGTCTCCTGCGTCCTATTCTTCTGCGATCCAGAATGGCAGCACAGCTGAAAGGTTTGTTTGAGCTGCGCCCTCTACTGCACAGACGTGAATATGCATTTCCTTCGGCTTTCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU377540 True 244 lncRNA 0.44 1 2785420 2785663

Neighbor

gene id symbol gene type direction distance location
CI01000113_02685260_02707606 SREBF1 coding upstream 76571 2685260 ~ 2708849 (+)
CI01000113_02623348_02657507 TOM1L2 coding upstream 127913 2623137 ~ 2657507 (+)
CI01000113_02548934_02576888 TBL3 coding upstream 207630 2548934 ~ 2577790 (+)
CI01000113_02418950_02434326 NA coding upstream 350964 2418950 ~ 2434456 (+)
CI01000113_02387553_02403367 SLC44A2 coding upstream 382053 2387553 ~ 2403367 (+)
G332058 NA non-coding upstream 73047 2712157 ~ 2712373 (+)
G332057 NA non-coding upstream 73492 2711676 ~ 2711928 (+)
G332054 NA non-coding upstream 82058 2702934 ~ 2703362 (+)
G332011 NA non-coding upstream 180512 2602338 ~ 2604908 (+)
G332042 NA non-coding upstream 228173 2555773 ~ 2557247 (+)
G332069 NA non-coding downstream 1523 2787186 ~ 2788491 (+)
G332102 NA non-coding downstream 9920 2795583 ~ 2803940 (+)
G332143 NA non-coding downstream 75918 2861581 ~ 2861898 (+)
G333019 NA non-coding downstream 83428 2869091 ~ 2869320 (+)
G333020 NA non-coding downstream 86867 2872530 ~ 2872730 (+)
CI01000113_02342987_02345449 SYCE2 other upstream 433550 2342987 ~ 2346006 (+)
G331759 NA other upstream 956517 1668002 ~ 1828903 (+)
G331767 NA other upstream 1122165 1662785 ~ 1663255 (+)
CI01000113_01424978_01425704 NA other upstream 1359714 1424968 ~ 1425835 (+)

Expression


Co-expression Network