G332143



Basic Information


Item Value
gene id G332143
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000113
NCBI id null
chromosome length 2886875
location 2861581 ~ 2861898 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU377587
GATCTATTACAGTTATACAGTTATATAGTATGGAAACTTTCTGTAAACCAATTGACCCTTCGCCAGGACTTTGATTGACAGGTGATCTAACCAATCATAACGCCGAATCCACCATTTTGTCCGACAAAGCAGTCAGGTGAGTTAGCAGATTAACGTAGGTGGACTTGAACTTGAAAAATGGTGTGTACTGACGTCTTTCCGCGGTTGAAACAACATTCCTTCTTTTGTTCATTCATGTTTATTTGATGCTATAAATGAAACTGGTAGAAAGAGATGATCGGTTCAGACCTTCACAAAGAAATGAATTATATATTCCCC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU377587 True 318 lncRNA 0.38 1 2861581 2861898

Neighbor


gene id symbol gene type direction distance location
CI01000113_02685260_02707606 SREBF1 coding upstream 152732 2685260 ~ 2708849 (+)
CI01000113_02623348_02657507 TOM1L2 coding upstream 204074 2623137 ~ 2657507 (+)
CI01000113_02548934_02576888 TBL3 coding upstream 283791 2548934 ~ 2577790 (+)
CI01000113_02418950_02434326 NA coding upstream 427125 2418950 ~ 2434456 (+)
CI01000113_02387553_02403367 SLC44A2 coding upstream 458214 2387553 ~ 2403367 (+)
G332102 NA non-coding upstream 57641 2795583 ~ 2803940 (+)
G332069 NA non-coding upstream 73090 2787186 ~ 2788491 (+)
G332098 NA non-coding upstream 75918 2785420 ~ 2785663 (+)
G332058 NA non-coding upstream 149208 2712157 ~ 2712373 (+)
G332057 NA non-coding upstream 149653 2711676 ~ 2711928 (+)
G333019 NA non-coding downstream 7193 2869091 ~ 2869320 (+)
G333020 NA non-coding downstream 10632 2872530 ~ 2872730 (+)
CI01000113_02342987_02345449 SYCE2 other upstream 509711 2342987 ~ 2346006 (+)
G331759 NA other upstream 1032678 1668002 ~ 1828903 (+)
G331767 NA other upstream 1198326 1662785 ~ 1663255 (+)
CI01000113_01424978_01425704 NA other upstream 1435875 1424968 ~ 1425835 (+)

Expression



Co-expression Network