G338124



Basic Information


Item Value
gene id G338124
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000120
NCBI id null
chromosome length 1315255
location 169438 ~ 169717 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU384579
AGTGAAATGATCGGTCATTTTCTAAAAAAAATAAAAAAATTATATACTTTTTAACCATGAATTCTTGTCTTGCTCTGTGATGTGCCACACATTACGTAATCACGTTGGAAAGGTCACGCGTGACGTAGGTGTAAGTACCGATCCAGTGTCTTCAAAGCGAAAGTGCAAAGACTAAGTCAAACGCCCTTTACAAAAAAATAAATAAACAAAAAAAAGGTAAAACAATGTTGTCGGATGATTTTGAAGTTGGAGGAGAAAATGAGATTCGCCCTTACCGTCG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU384579 True 280 lncRNA 0.36 1 169438 169717

Neighbor


gene id symbol gene type direction distance location
CI01000120_00149999_00157598 NA coding upstream 10767 149999 ~ 158671 (+)
CI01000120_00051711_00088727 DUSP8, DUSP8A coding upstream 80711 51711 ~ 88727 (+)
CI01000120_00002703_00007355 NA coding upstream 161509 2703 ~ 7929 (+)
CI01000120_00308876_00311801 NA coding downstream 138971 308688 ~ 311900 (+)
CI01000120_00322439_00323110 NA coding downstream 152630 322347 ~ 323212 (+)
CI01000120_00451804_00456525 NA coding downstream 279813 449530 ~ 457774 (+)
CI01000120_00459245_00460500 MYOD1, MYOD2, MYOD1C coding downstream 289310 459027 ~ 461043 (+)
CI01000120_00477162_00480891 NA coding downstream 307282 476999 ~ 481125 (+)
G338110 NA non-coding upstream 176 163941 ~ 169262 (+)
G338134 NA non-coding upstream 70068 99111 ~ 99370 (+)
G338120 NA non-coding upstream 97700 63186 ~ 71738 (+)
G338125 NA non-coding upstream 138426 30703 ~ 31012 (+)
G338130 NA non-coding upstream 144728 20606 ~ 24710 (+)
G338156 NA non-coding downstream 49528 219245 ~ 219548 (+)
G338185 NA non-coding downstream 125596 295313 ~ 295602 (+)
G338188 NA non-coding downstream 154318 324035 ~ 324462 (+)
G338189 NA non-coding downstream 154798 324515 ~ 324771 (+)
G338190 NA non-coding downstream 155161 324878 ~ 353140 (+)
G338386 NA other downstream 593560 763277 ~ 763643 (+)
G338458 NA other downstream 694841 864558 ~ 865315 (+)
G338464 NA other downstream 709094 878811 ~ 879593 (+)
G338508 NA other downstream 837348 1007065 ~ 1009403 (+)
CI01000120_01141788_01144915 DYNLRB2, DYNLRB2.L other downstream 970123 1141788 ~ 1145086 (+)

Expression



Co-expression Network