G338233


Basic Information

Item Value
gene id G338233
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000120
NCBI id null
chromosome length 1315255
location 399344 ~ 399553 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU384712
TGGTAAGTCTGACAGACTGAGTCATTGATGAGCTGGAGTGAAAATGGATCCTCCTTAAATATTTTTACAGTCGACATGGCCTTGTCTTGTTATCTAAGAGAAGTATATCTAATGGGTAACCTCCAGAGATTTAATATGAAGAAAAACTAGTGTAATATTGAAATAGTATGTGAAAAATTTGTTTCCAAAACTTCTGCCTTTCAGTCTCTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU384712 True 210 lncRNA 0.34 1 399344 399553

Neighbor

gene id symbol gene type direction distance location
CI01000120_00322439_00323110 NA coding upstream 76132 322347 ~ 323212 (+)
CI01000120_00308876_00311801 NA coding upstream 87444 308688 ~ 311900 (+)
CI01000120_00149999_00157598 NA coding upstream 240673 149999 ~ 158671 (+)
CI01000120_00051711_00088727 DUSP8, DUSP8A coding upstream 310617 51711 ~ 88727 (+)
CI01000120_00002703_00007355 NA coding upstream 391415 2703 ~ 7929 (+)
CI01000120_00451804_00456525 NA coding downstream 49977 449530 ~ 457774 (+)
CI01000120_00459245_00460500 MYOD1, MYOD2, MYOD1C coding downstream 59474 459027 ~ 461043 (+)
CI01000120_00477162_00480891 NA coding downstream 77446 476999 ~ 481125 (+)
CI01000120_00612213_00613803 NA coding downstream 212660 612213 ~ 614230 (+)
CI01000120_00639875_00643491 RASK, KRAS coding downstream 239498 639051 ~ 643520 (+)
G338190 NA non-coding upstream 46204 324878 ~ 353140 (+)
G338189 NA non-coding upstream 74573 324515 ~ 324771 (+)
G338188 NA non-coding upstream 74882 324035 ~ 324462 (+)
G338185 NA non-coding upstream 103742 295313 ~ 295602 (+)
G338156 NA non-coding upstream 179796 219245 ~ 219548 (+)
G338223 NA non-coding downstream 14661 414214 ~ 464433 (+)
G338273 NA non-coding downstream 128073 527626 ~ 527848 (+)
G338209 NA non-coding downstream 139283 538836 ~ 554633 (+)
G338281 NA non-coding downstream 156792 556345 ~ 556563 (+)
G338283 NA non-coding downstream 159899 559452 ~ 559690 (+)
G338386 NA other downstream 363724 763277 ~ 763643 (+)
G338458 NA other downstream 465005 864558 ~ 865315 (+)
G338464 NA other downstream 479258 878811 ~ 879593 (+)
G338508 NA other downstream 607512 1007065 ~ 1009403 (+)
CI01000120_01141788_01144915 DYNLRB2, DYNLRB2.L other downstream 740287 1141788 ~ 1145086 (+)

Expression


Co-expression Network