G338288


Basic Information

Item Value
gene id G338288
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000120
NCBI id null
chromosome length 1315255
location 582806 ~ 583474 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU384767
CTATGTAAAAATGTGTTTTTTTTAAAGTAAGTGTAACCATATTTATTAAAAGTAAAGAATTTTTGGAAAGACAGTTCTCATATTCAAAAAGGCAGGTTTGAAGCAAATCTCACCATTTTGTTTGGAATGCTTTTTCTTATCCAGCTGATGAGGTGCCATGATGTCTCTGCTCCATTTTTCCAGCGTTTCCATCTTCCACCCCCCCAGCCATTCATCTTTGCAGCGCTCAGCTGAATG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU384767 True 237 lncRNA 0.38 2 582806 583474

Neighbor

gene id symbol gene type direction distance location
CI01000120_00477162_00480891 NA coding upstream 101681 476999 ~ 481125 (+)
CI01000120_00459245_00460500 MYOD1, MYOD2, MYOD1C coding upstream 121763 459027 ~ 461043 (+)
CI01000120_00451804_00456525 NA coding upstream 125032 449530 ~ 457774 (+)
CI01000120_00322439_00323110 NA coding upstream 259594 322347 ~ 323212 (+)
CI01000120_00308876_00311801 NA coding upstream 270906 308688 ~ 311900 (+)
CI01000120_00612213_00613803 NA coding downstream 28739 612213 ~ 614230 (+)
CI01000120_00639875_00643491 RASK, KRAS coding downstream 55577 639051 ~ 643520 (+)
CI01000120_00704598_00707678 NA coding downstream 120813 704287 ~ 708495 (+)
CI01000120_00731213_00760512 NA coding downstream 147506 730936 ~ 760760 (+)
CI01000120_01093808_01118807 NA coding downstream 510334 1093808 ~ 1118807 (+)
G338289 NA non-coding upstream 611 581990 ~ 582195 (+)
G338219 NA non-coding upstream 15414 561956 ~ 567392 (+)
G338283 NA non-coding upstream 23116 559452 ~ 559690 (+)
G338281 NA non-coding upstream 26243 556345 ~ 556563 (+)
G338209 NA non-coding upstream 28173 538836 ~ 554633 (+)
G338290 NA non-coding downstream 1515 584989 ~ 585217 (+)
G338292 NA non-coding downstream 9260 592734 ~ 596342 (+)
G338119 NA non-coding downstream 15836 599310 ~ 599848 (+)
G338296 NA non-coding downstream 20021 603495 ~ 603747 (+)
G338298 NA non-coding downstream 21016 604490 ~ 604903 (+)
G338386 NA other downstream 179803 763277 ~ 763643 (+)
G338458 NA other downstream 281084 864558 ~ 865315 (+)
G338464 NA other downstream 295337 878811 ~ 879593 (+)
G338508 NA other downstream 423591 1007065 ~ 1009403 (+)
CI01000120_01141788_01144915 DYNLRB2, DYNLRB2.L other downstream 556366 1141788 ~ 1145086 (+)

Expression


Co-expression Network