G338386



Basic Information


Item Value
gene id G338386
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000120
NCBI id null
chromosome length 1315255
location 763277 ~ 763643 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU384877
AGAAAATCGGCATGCAAGTTCATTGCAGTTATCTAAAGAAGTAAAAAGCTAAACTGGGGTGACTATTTCCTGTGACACAATACGGCGTAGGAATGGCATGCGTGGGTGCCGTCCACAAAAGAAGTTTCTCCTAAAGCCCAGGCACAAAAAAGCCCGCCTAGAGTTTGCCAGGGCCCATGCTGACAAAGATGAAGACTACTGGGACTCTATACTCTGGAGTGATGAGACCAAGATAAATGTTTTTGGAACTGATGGCTTCAAAACTGTATGGCGTTGCAAAGGTGAGGAATACAAAGAAAAATGCATGGTGCCTACAGTGAAACATGGTGGTGGCAGAGTCCTTATGTGGGGCTGCATGAGTGCTGCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU384877 True 367 TUCP 0.46 1 763277 763643
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000120_00731213_00760512 NA coding upstream 2517 730936 ~ 760760 (+)
CI01000120_00704598_00707678 NA coding upstream 54782 704287 ~ 708495 (+)
CI01000120_00639875_00643491 RASK, KRAS coding upstream 119757 639051 ~ 643520 (+)
CI01000120_00612213_00613803 NA coding upstream 149047 612213 ~ 614230 (+)
CI01000120_00477162_00480891 NA coding upstream 282152 476999 ~ 481125 (+)
CI01000120_01093808_01118807 NA coding downstream 330165 1093808 ~ 1118807 (+)
CI01000120_01141788_01144915 DYNLRB2, DYNLRB2.L coding downstream 378145 1141788 ~ 1145086 (+)
CI01000120_01194995_01221974 NA coding downstream 431352 1194995 ~ 1222463 (+)
CI01000120_01233281_01240955 SIGIRR coding downstream 469250 1232893 ~ 1241149 (+)
G338384 NA non-coding upstream 1198 761765 ~ 762079 (+)
G338379 NA non-coding upstream 7672 755337 ~ 755605 (+)
G338377 NA non-coding upstream 10425 752606 ~ 752852 (+)
G338374 NA non-coding upstream 13081 749832 ~ 750196 (+)
G338373 NA non-coding upstream 13926 749040 ~ 749351 (+)
G338388 NA non-coding downstream 3376 767019 ~ 767332 (+)
G338390 NA non-coding downstream 5482 769125 ~ 769473 (+)
G338391 NA non-coding downstream 7611 771254 ~ 771541 (+)
G338392 NA non-coding downstream 8012 771655 ~ 771978 (+)
G338393 NA non-coding downstream 8427 772070 ~ 772299 (+)
G338458 NA other downstream 100915 864558 ~ 865315 (+)
G338464 NA other downstream 115168 878811 ~ 879593 (+)
G338508 NA other downstream 243422 1007065 ~ 1009403 (+)

Expression


G338386 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G338386 Expression in each Bioproject

Bar chart with 33 bars.
G338386 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network