G350848



Basic Information


Item Value
gene id G350848
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000140
NCBI id null
chromosome length 2494207
location 1569266 ~ 1576119 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU399506
GTACAATGGATGAAGCACGATGGATGAAGCTGCAGCACAGAGAACAGAGAAACAGCACCAGCAGAGGATCCAGCACAGACAGAAAGATCTTCAGCAGCTGAGAGAGGCTGTGGAGTCTCATAAGCGCTCTGCACAGACAGCAGTGGAGGACAGTGAGAGGATCTTCACTGAGCTCATCCGCTCCATCGAGAGAAGCCGCTCTGAGGCCACACAGCGGATCAGAGATCAGGAAAAGACTGCAGTGAGTCGAGCTGAAGGACGACTGGAGCGACTGGAGCAGGAGATCAATGATCTGAGGAGGAGAGACGCTGAGCTGGAGCAGCTTTCACACACACAGGATCACATCCATTTCCTGCAGAGTTTCCAGTCTCTCTCAGCTCCTCCTGAATCTACAGATGTAAATGACAATCCCTTCATTTCTCTCTTCTCTTTTGATGGCGTGAGAGAATCT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU399506 True 451 TUCP 0.51 4 1569266 1576119
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000140_01550712_01553934 NA coding upstream 15099 1550712 ~ 1554167 (+)
CI01000140_01536330_01540225 NA coding upstream 28886 1535269 ~ 1540380 (+)
CI01000140_01186591_01191455 NA coding upstream 377222 1186398 ~ 1192044 (+)
CI01000140_01106090_01106567 NA coding upstream 462611 1106090 ~ 1106655 (+)
CI01000140_01058442_01103457 NA coding upstream 465809 1058191 ~ 1103457 (+)
CI01000140_01582537_01630093 NA coding downstream 6264 1582383 ~ 1630396 (+)
CI01000140_01688652_01717386 NA coding downstream 110827 1686946 ~ 1718419 (+)
CI01000140_01807220_01815038 NA coding downstream 229580 1805699 ~ 1815769 (+)
CI01000140_01885335_01887127 NA coding downstream 309139 1885258 ~ 1887752 (+)
CI01000140_01948258_01949562 NA coding downstream 372139 1948258 ~ 1950091 (+)
G350899 NA non-coding upstream 9028 1557532 ~ 1560238 (+)
G350835 NA non-coding upstream 111248 1456535 ~ 1458018 (+)
G350833 NA non-coding upstream 115624 1451623 ~ 1453642 (+)
G350828 NA non-coding upstream 165698 1403313 ~ 1403568 (+)
G350850 NA non-coding downstream 202548 1778667 ~ 1781774 (+)
G350847 NA non-coding downstream 245657 1821776 ~ 1826782 (+)
G350830 NA non-coding downstream 332500 1908619 ~ 1969478 (+)
G350831 NA non-coding downstream 401026 1977145 ~ 1979294 (+)
G350836 NA non-coding downstream 410337 1986456 ~ 1988053 (+)
G350901 NA other upstream 44094 1515978 ~ 1525172 (+)
G350832 NA other upstream 61558 1504386 ~ 1507708 (+)
G350762 NA other upstream 528458 1039556 ~ 1040808 (+)
CI01000140_00799875_00859860 SSPO, SCOSPONDIN other upstream 765560 798874 ~ 859860 (+)

Expression


G350848 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G350848 Expression in each Bioproject

Bar chart with 44 bars.
G350848 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network