Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

economic fish

G356276

Basic Information

Item	Value
gene id	G356276
gene name	NA
gene type	non-coding
species	grasscarp (Ctenopharyngodon idella)
category of species	economic fish

Chromosome Information

Item	Value
chromosome id	CI01000147
NCBI id	null
chromosome length	707134
location	63810 ~ 64036 (-)
genome version	v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU406186
TTTTAATTTTCTGTCGGACTTAGTACACGATGTAACTACAGAAGAGTCAAGTTTTAAATAGGAAAAATATTGAAACTCTTTGGTCATTTTTTAACGAGATGCTAACGGTCTAATCGGATTCAATGAACTATGCTAAGCTATGCTAAAAGTGGTACCGCCAGACCCGGAGATCGGCTGAATGGATTCGAAAATGGTAAAACTCAACTGTTTAACTCTAGGGGAATTGG

Function

GO:

id	name	namespace
GO:0016071	mRNA metabolic process	biological_process
GO:0000375	RNA splicing, via transesterification reactions	biological_process
GO:0000377	RNA splicing, via transesterification reactions with bulged adenosine as nucleophile	biological_process
GO:0006397	mRNA processing	biological_process
GO:0000398	mRNA splicing, via spliceosome	biological_process
GO:0016607	nuclear speck	cellular_component
GO:0005681	spliceosomal complex	cellular_component
GO:0005685	U1 snRNP	cellular_component

KEGG:

id	description
ko03040	Spliceosome

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TU406186	True	227	lncRNA	0.37	1	63810	64036

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
CI01000147_00231088_00236774	AASDHPPT	coding	upstream	167021	231057 ~ 236774 (-)
CI01000147_00252331_00335060	GRIA4A, GRIA4	coding	upstream	188111	248563 ~ 335060 (-)
CI01000147_00426318_00471016	DYNC2H1	coding	upstream	362282	426318 ~ 471016 (-)
CI01000147_00482393_00489991	DYNC2H1	coding	upstream	418357	482393 ~ 489991 (-)
CI01000147_00491199_00512572	DYNC2H1	coding	upstream	427163	491199 ~ 513215 (-)
G356275	NA	non-coding	downstream	3794	53475 ~ 60016 (-)
G356274	NA	non-coding	downstream	12857	48047 ~ 50953 (-)
G356281	NA	non-coding	upstream	13456	77492 ~ 77718 (-)
G356261	NA	non-coding	upstream	18111	82147 ~ 109196 (-)
G356291	NA	non-coding	upstream	61054	125090 ~ 125675 (-)
G356297	NA	non-coding	upstream	61839	125875 ~ 126193 (-)
G356301	NA	non-coding	upstream	66365	130401 ~ 130940 (-)
G356249	NA	other	downstream	23968	14927 ~ 39842 (-)

Expression

Co-expression Network