G359194



Basic Information


Item Value
gene id G359194
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000152
NCBI id null
chromosome length 3381324
location 1464078 ~ 1464328 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU409710
ACCATTCATATTTAAATTTTTTAGCACACCAGGGTGACTAGGAGCATGAAATTGTCCAGCCATGACTTCCTGTTCCATAGGAGTATAAACATGAGGAAACACAAAGGCCAAATTCCCTTAATCATTCATCACAATGAGTAAAACCAAAGAATATAGTTCTGATGTGCAGCAAAAGATTGTTGAGCTTCACAAAATAGAAAATGGCTATAAGAAAAAAGCTAAAGCATTGAAAATTCCCATTTCCACTATCA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU409710 True 251 lncRNA 0.35 1 1464078 1464328
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000152_01429044_01451054 LIG1 coding downstream 13024 1428865 ~ 1451054 (-)
CI01000152_01415414_01419131 MYP0, MPZ coding downstream 44015 1415310 ~ 1420063 (-)
CI01000152_01380778_01397434 ATP1A2A coding downstream 66644 1380140 ~ 1397434 (-)
CI01000152_01375796_01378931 SDHC coding downstream 84059 1375443 ~ 1380019 (-)
CI01000152_01296980_01330911 CADM3 coding downstream 133167 1296690 ~ 1330911 (-)
CI01000152_01545763_01547190 NA coding upstream 81006 1545334 ~ 1547190 (-)
CI01000152_01557532_01565618 NA coding upstream 92897 1557225 ~ 1565618 (-)
CI01000152_01567745_01570475 PIH1D3 coding upstream 103380 1567546 ~ 1570475 (-)
CI01000152_01584481_01585153 NA coding upstream 119503 1583831 ~ 1585268 (-)
CI01000152_01755247_01760266 MAP6D1 coding upstream 290802 1755130 ~ 1760675 (-)
G359124 NA non-coding downstream 174005 1287518 ~ 1290073 (-)
G359126 NA non-coding downstream 278745 1184246 ~ 1185333 (-)
CI01000152_01140574_01151786 NA non-coding downstream 309739 1140213 ~ 1152870 (-)
G359080 NA non-coding downstream 345572 1024434 ~ 1118506 (-)
G359198 NA non-coding upstream 2378 1466706 ~ 1467174 (-)
G359199 NA non-coding upstream 4917 1469245 ~ 1471571 (-)
G359200 NA non-coding upstream 7433 1471761 ~ 1471961 (-)
G359202 NA non-coding upstream 7971 1472299 ~ 1535242 (-)
G359224 NA non-coding upstream 65399 1529727 ~ 1530773 (-)
G359178 NA other downstream 120073 1337660 ~ 1344005 (-)
CI01000152_00562189_00571618 CREMA other downstream 898794 560484 ~ 572648 (-)
CI01000152_01892421_01893463 CAMK2N2, CAMK2N1A other upstream 426530 1890149 ~ 1893866 (-)
CI01000152_02015257_02024292 CAPN10 other upstream 557211 2015257 ~ 2024292 (-)
G359788 NA other upstream 853940 2318268 ~ 2318734 (-)
G359800 NA other upstream 904664 2368992 ~ 2459836 (-)

Expression


G359194 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G359194 Expression in each Bioproject

Bar chart with 35 bars.
G359194 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network